G1041049



Basic Information


Item Value
gene id G1041049
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 14793947 ~ 14794188 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1186343
gcggcctttctcaatagcaaggctatgctcactgagtctgtacatagtcaaagctttccttaattttgggtcagtcacagtggtcaggtattctgccactgtgtactctctgtttagggccaaatagcattctagtttgctctgtttttttgttaattctttccaatgtgtcaagtaattatctttttgttttctcatgatttggttgggtctaattgtgctgttgtcctggggctctgtag

Function


NR:

description
PREDICTED: uncharacterized protein LOC104955046

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1186343 True 242 lncRNA 0.41 1 14793947 14794188
Loading

Neighbor


gene id symbol gene type direction distance location
tdgf1 LOC106568419 coding downstream 540999 14249910 ~ 14252948 (-)
zmp:0000001301 LOC106568410 coding downstream 580371 14198158 ~ 14213576 (-)
LOC110537014 LOC106568411 coding downstream 595920 14180403 ~ 14198027 (-)
LOC110537010 LOC106568408 coding downstream 638619 14120153 ~ 14155328 (-)
plpp1a plpp1 coding downstream 685753 14083339 ~ 14108194 (-)
LOC110537020 LOC106568373 coding upstream 35433 14829621 ~ 14831545 (-)
c3ar1 c3ar1 coding upstream 75551 14869739 ~ 14875572 (-)
LOC110537021 LOC106568367 coding upstream 102160 14896348 ~ 14946975 (-)
LOC110537023 NA coding upstream 275884 15070072 ~ 15075473 (-)
LOC110537026 LOC106568365 coding upstream 291729 15085917 ~ 15096696 (-)
G1041048 NA non-coding downstream 1910 14791828 ~ 14792037 (-)
G1040975 NA non-coding downstream 121003 14670057 ~ 14672944 (-)
G1040863 NA non-coding downstream 279359 14491274 ~ 14514588 (-)
G1040597 NA non-coding downstream 362014 14431720 ~ 14431933 (-)
G1040593 NA non-coding downstream 366674 14426469 ~ 14427273 (-)
G1041131 NA non-coding upstream 61864 14856052 ~ 14856278 (-)
G1041132 NA non-coding upstream 62483 14856671 ~ 14856898 (-)
G1041138 NA non-coding upstream 66429 14860617 ~ 14861126 (-)
G1041831 NA non-coding upstream 83056 14877244 ~ 14877536 (-)
G1041859 NA non-coding upstream 145604 14939792 ~ 14941546 (-)
G1040432 LOC106568413 other downstream 482895 14307600 ~ 14311052 (-)
G1040300 NA other downstream 613806 14178658 ~ 14180141 (-)
G1039504 NA other downstream 1438152 13355300 ~ 13355795 (-)
LOC110536986 LOC106568381 other downstream 1471231 13321118 ~ 13324415 (-)
G1039366 NA other downstream 1641640 13151021 ~ 13152307 (-)
G1042500 NA other upstream 1309975 16104163 ~ 16104883 (-)
LOC110537059 LOC106568318 other upstream 1530775 16324956 ~ 16328168 (-)
LOC110537061 LOC106568319 other upstream 1739429 16417638 ~ 16549073 (-)
LOC110537077 LOC106568284 other upstream 2271133 17065241 ~ 17068020 (-)
G1044482 NA other upstream 2901941 17696129 ~ 17697105 (-)

Expression


G1041049 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

G1041049 Expression in each Bioproject

Bar chart with 20 bars.
G1041049 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network