G1041831



Basic Information


Item Value
gene id G1041831
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 14877244 ~ 14877536 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1187250
TCTGCTGGGAAACTGAAACTTATATTTCACCCTGAGTTCCCTTTTTATCTTCCCTGTGTTACATTCCTCCTAATGGATGTAGGAGCTATATAAATAGGATGACGAAAATGAACAAATCCCCTCAGACCACAACAATGTGAAAGTACACTTAAGGGAATGTCCGTTCCAGTAAATATCTTTCTGTATTTAAACTTGGAATCTGCCTTCTATGTCCTGTATGACTATCATTGGCCAATGCTGTAGTGTATTGATGTGGACAATAATTACACTTAATTAAATGTTATACCATCCAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1187250 True 293 lncRNA 0.37 1 14877244 14877536
Loading

Neighbor


gene id symbol gene type direction distance location
c3ar1 c3ar1 coding downstream 1672 14869739 ~ 14875572 (-)
LOC110537020 LOC106568373 coding downstream 45699 14829621 ~ 14831545 (-)
tdgf1 LOC106568419 coding downstream 624296 14249910 ~ 14252948 (-)
zmp:0000001301 LOC106568410 coding downstream 663668 14198158 ~ 14213576 (-)
LOC110537014 LOC106568411 coding downstream 679217 14180403 ~ 14198027 (-)
LOC110537021 LOC106568367 coding upstream 18812 14896348 ~ 14946975 (-)
LOC110537023 NA coding upstream 192536 15070072 ~ 15075473 (-)
LOC110537026 LOC106568365 coding upstream 208381 15085917 ~ 15096696 (-)
LOC110537025 dab2 coding upstream 222008 15099544 ~ 15114328 (-)
LOC110537028 LOC106568361 coding upstream 274473 15152009 ~ 15154387 (-)
G1041138 NA non-coding downstream 16118 14860617 ~ 14861126 (-)
G1041132 NA non-coding downstream 20346 14856671 ~ 14856898 (-)
G1041131 NA non-coding downstream 20966 14856052 ~ 14856278 (-)
G1041049 NA non-coding downstream 83056 14793947 ~ 14794188 (-)
G1041048 NA non-coding downstream 85207 14791828 ~ 14792037 (-)
G1041859 NA non-coding upstream 62256 14939792 ~ 14941546 (-)
G1041866 NA non-coding upstream 70948 14948484 ~ 14948692 (-)
G1041871 NA non-coding upstream 76213 14953749 ~ 14953986 (-)
G1041895 NA non-coding upstream 115224 14992760 ~ 15038648 (-)
G1041932 LOC100136130 non-coding upstream 175688 15053224 ~ 15138711 (-)
G1040432 LOC106568413 other downstream 566192 14307600 ~ 14311052 (-)
G1040300 NA other downstream 697103 14178658 ~ 14180141 (-)
G1039504 NA other downstream 1521449 13355300 ~ 13355795 (-)
LOC110536986 LOC106568381 other downstream 1554528 13321118 ~ 13324415 (-)
G1039366 NA other downstream 1724937 13151021 ~ 13152307 (-)
G1042500 NA other upstream 1226627 16104163 ~ 16104883 (-)
LOC110537059 LOC106568318 other upstream 1447427 16324956 ~ 16328168 (-)
LOC110537061 LOC106568319 other upstream 1656081 16417638 ~ 16549073 (-)
LOC110537077 LOC106568284 other upstream 2187785 17065241 ~ 17068020 (-)
G1044482 NA other upstream 2818593 17696129 ~ 17697105 (-)

Expression


G1041831 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1041831 Expression in each Bioproject

Bar chart with 15 bars.
G1041831 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network