G1043026



Basic Information


Item Value
gene id G1043026
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 16608512 ~ 16608845 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1188615
ggttaggacatctactttgtgcatgacacaagtaatttttccaacaattgtttacagacagattatttcacttataattcactgtatcacaaatccagtgggtcagaagtttacatacactaagttgactgtgcatttaaacatcttggaaaattccagaaactgatgtcattgctttagaaggttctgatagtctaattgatataattttagtcaattggaggtgtacctgtggatgcatttcaatttgtatttgtagacctccacaagtctggttcatccttgggagcaatttccaagttgaagaacaccatcccaactgtgaagcacgggg

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1188615 True 334 lncRNA 0.37 1 16608512 16608845
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537062 csn4 coding downstream 31665 16569486 ~ 16576847 (-)
LOC110537061 LOC106568319 coding downstream 59439 16417638 ~ 16549073 (-)
LOC110537059 LOC106568318 coding downstream 280344 16324956 ~ 16328168 (-)
ppwd1 ppwd1 coding downstream 283750 16320428 ~ 16324762 (-)
mzt2b LOC106568316 coding downstream 296166 16307357 ~ 16312346 (-)
LOC110537069 LOC106568328 coding upstream 7522 16616367 ~ 16630120 (-)
LOC100305243 LOC106562364 coding upstream 28645 16634735 ~ 16638951 (-)
LOC110537074 LOC106562412 coding upstream 331582 16940427 ~ 17041905 (-)
LOC110537073 LOC106568283 coding upstream 433526 17042371 ~ 17064591 (-)
LOC110537077 LOC106568284 coding upstream 456396 17065241 ~ 17068020 (-)
G1043022 LOC100380853 non-coding downstream 4073 16604212 ~ 16604439 (-)
G1043017 NA non-coding downstream 9746 16598458 ~ 16598766 (-)
G1043015 NA non-coding downstream 10228 16597714 ~ 16598284 (-)
G1042955 NA non-coding downstream 117912 16488923 ~ 16490600 (-)
G1042754 NA non-coding downstream 192046 16416205 ~ 16416466 (-)
G1043027 NA non-coding upstream 1258 16610103 ~ 16611141 (-)
G1043030 NA non-coding upstream 31762 16640607 ~ 16640850 (-)
G1043055 NA non-coding upstream 98920 16707765 ~ 16764710 (-)
G1043066 NA non-coding upstream 109857 16718702 ~ 16720707 (-)
G1042500 NA other downstream 503629 16104163 ~ 16104883 (-)
G1040432 LOC106568413 other downstream 2297460 14307600 ~ 14311052 (-)
G1040300 NA other downstream 2428371 14178658 ~ 14180141 (-)
G1044482 NA other upstream 1087284 17696129 ~ 17697105 (-)
G1044649 LOC106568140 other upstream 1409259 18018104 ~ 18018758 (-)
G1044671 NA other upstream 1447266 18056111 ~ 18058392 (-)
G1044692 NA other upstream 1488718 18097563 ~ 18099722 (-)

Expression


G1043026 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1043026 Expression in each Bioproject

Bar chart with 19 bars.
G1043026 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network