G1044482



Basic Information


Item Value
gene id G1044482
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 17696129 ~ 17697105 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1190341
caactataaatacctaggtgtctggctagactgtaaactctccttccagactcatattaaatatctccaatccaaaatcaaatctagaatcggctttctatttcgcaacaaagcctccttcactcacgccgccaaacttaccctcgtaaaactgactatcctaccgatcctcgacttcggcgatgtcatctacaaaatagcttccaacactctactcagcaaactggatgcagtttatcacagtgccatccgttttgttaccaaatcaccttataccacccgacctgtatgctctagtcggctggtcctcactacatatttgtcgccagacccactggctccaggtcatctataagtctatgctaggtaaagctccgccttatctcagttcactggtcacgataacaacacccacccgtagcacacgttccagcaggtgtatctcactgatcatccctaaagccaacaccccatttggccgcctttccttccagttctctgctgccagtgactggaacgaattgcaaaaatcgctgaagttggagacttttatttccctcaccaactttaaacatcaactatgagcagctaaccgatcgctgcagctgtaaatagcccacccaatctacctacctcatccccatactgtttttagtttatttacttttctgcccttttgcacaccagtatctctacttgcacatcatcatctgctcatttatcactccagtgttaatctgctaaattgtaattattcgctcctatggcctatttattacctacctcctcatgtcttctgcacacactgtatatagactttcttttttctactgtgtcattgcttgtttattgtttactccatgtgtaactctgtgttgttgtctgtgtcacactgctttgctttatcttggccaggtcgcagttgcaaatgagaacttgttctcaactagcctacct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1190341 True 957 TUCP 0.44 2 17696129 17697105

Neighbor


gene id symbol gene type direction distance location
LOC110537096 LOC106562702 coding downstream 119592 17557135 ~ 17576537 (-)
LOC110537091 LOC106568276 coding downstream 171742 17502204 ~ 17524387 (-)
LOC110537089 tmed2 coding downstream 416991 17275246 ~ 17279138 (-)
ddx55 ddx55 coding downstream 421031 17269677 ~ 17275098 (-)
LOC110537086 LOC106568301 coding downstream 439855 17250072 ~ 17256274 (-)
LOC110537102 LOC106568267 coding upstream 24072 17721177 ~ 17729244 (-)
LOC110536806 LOC106568132 coding upstream 56858 17753963 ~ 17808512 (-)
LOC110537108 LOC106563398 coding upstream 162995 17860100 ~ 17863387 (-)
LOC110537109 pp2bc coding upstream 194789 17891894 ~ 17912969 (-)
LOC100135895 LOC100135895 coding upstream 238623 17935728 ~ 17940707 (-)
G1043996 NA non-coding downstream 15245 17680677 ~ 17680884 (-)
G1043986 NA non-coding downstream 24188 17671644 ~ 17671941 (-)
G1043950 LOC106568269 non-coding downstream 43445 17652288 ~ 17652684 (-)
G1043980 pi4ka non-coding downstream 51517 17643604 ~ 17644612 (-)
G1043887 NA non-coding downstream 69746 17595109 ~ 17626383 (-)
G1044486 NA non-coding upstream 6060 17703165 ~ 17703578 (-)
G1044488 NA non-coding upstream 9158 17706263 ~ 17706541 (-)
G1044513 NA non-coding upstream 32398 17729503 ~ 17732067 (-)
G1044516 NA non-coding upstream 38781 17735886 ~ 17736114 (-)
G1044517 NA non-coding upstream 39268 17736373 ~ 17736643 (-)
LOC110537077 LOC106568284 other downstream 628244 17065241 ~ 17068020 (-)
LOC110537061 LOC106568319 other downstream 1151403 16417638 ~ 16549073 (-)
LOC110537059 LOC106568318 other downstream 1368015 16324956 ~ 16328168 (-)
G1042500 NA other downstream 1591246 16104163 ~ 16104883 (-)
G1040432 LOC106568413 other downstream 3385077 14307600 ~ 14311052 (-)
G1044649 LOC106568140 other upstream 320999 18018104 ~ 18018758 (-)
G1044671 NA other upstream 359006 18056111 ~ 18058392 (-)
G1044692 NA other upstream 400458 18097563 ~ 18099722 (-)
G1044761 NA other upstream 495129 18192234 ~ 18193223 (-)
LOC110537121 LOC106568150 other upstream 749576 18439759 ~ 18458056 (-)

Expression


G1044482 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1044482 Expression in each Bioproject

Bar chart with 20 bars.
G1044482 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network