G1044013



Basic Information


Item Value
gene id G1044013
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 17706222 ~ 17706624 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1189768
gtgttattttagtgttcccttttttttgagcagtgtacaaatggtatagagggaaatagtcctataattcctataataactacaacctaaaacttcttacctgggaatattgaagactcatgttaaaaaggaaccaccagctttcatatgttctcatgttctgagcaaggaactgaaatgttagctttcttacatggcacatattttacatggaacatattgcacttttactttcttctccaacactttgtttttgcattatttaaaccaaattgaacatgatccattatttacttgaggctaaattgattttattgatgttttatattaagttaaaataagtgttcattcagtattgttgtaattgtcattattacaaataaataaataaaaaaattcaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1189768 True 403 lncRNA 0.28 1 17706222 17706624

Neighbor


gene id symbol gene type direction distance location
LOC110537098 pi4ka coding upstream 42544 17618250 ~ 17663678 (+)
LOC110537097 LOC106568272 coding upstream 109087 17579225 ~ 17597135 (+)
LOC110537094 ci167 coding upstream 147178 17543370 ~ 17594573 (+)
LOC110536805 brap coding upstream 167445 17529711 ~ 17538777 (+)
LOC110537092 LOC106568278 coding upstream 204123 17468311 ~ 17502099 (+)
LOC110537101 LOC106562742 coding downstream 7536 17714160 ~ 17717729 (+)
LOC110537103 xpo7 coding downstream 124598 17831222 ~ 17858119 (+)
LOC110537106 LOC106568134 coding downstream 156893 17863517 ~ 17886525 (+)
LOC118937634 NA coding downstream 182750 17888059 ~ 17891148 (+)
LOC110539121 LOC106608263 coding downstream 257643 17964267 ~ 17965587 (+)
G1043999 NA non-coding upstream 13938 17692019 ~ 17692284 (+)
G1043997 LOC106568268 non-coding upstream 17167 17681840 ~ 17689055 (+)
G1043827 NA non-coding upstream 38665 17667280 ~ 17667557 (+)
G1043824 NA non-coding upstream 65141 17640303 ~ 17641081 (+)
G1044006 NA non-coding downstream 12157 17718781 ~ 17718986 (+)
G1044020 NA non-coding downstream 25639 17732263 ~ 17732472 (+)
G1044024 NA non-coding downstream 30611 17737235 ~ 17737699 (+)
G1044004 NA non-coding downstream 45565 17752189 ~ 17752980 (+)
G1044005 NA non-coding downstream 47201 17753825 ~ 17754811 (+)
G1043449 tmed2 other upstream 427104 17275268 ~ 17279118 (+)
G1043245 NA other upstream 714877 16909786 ~ 16991345 (+)
G1041576 yo84 other upstream 2097770 15604625 ~ 15608452 (+)
G1041494 LOC106568352 other upstream 2188460 15464803 ~ 15564470 (+)
G1041432 NA other upstream 2343480 15344919 ~ 15362742 (+)
G1044002 NA other downstream 14469 17721093 ~ 17729254 (+)
G1044056 NA other downstream 180029 17886653 ~ 17887917 (+)
G1044201 NA other downstream 369178 18075802 ~ 18077300 (+)
G1044265 NA other downstream 589306 18295930 ~ 18296402 (+)
G1044317 NA other downstream 686022 18392646 ~ 18393341 (+)

Expression


G1044013 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1044013 Expression in each Bioproject

Bar chart with 21 bars.
G1044013 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network