G1045364 (rxfp3)



Basic Information


Item Value
gene id G1045364
gene name rxfp3
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 18933704 ~ 18933983 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1191310
CCAGAATTGTGCGTCAACGGTGTCTGGAAATTTAACAAGGCACAGTTCCTCGTTGGAGACAGTCGCCGTTGTGGAGAACACCGCATGGGGCAAAGCTGCGGATATAGCAGCAACCCATATAACAACGCTCATAAAGCGCGCGGAGCAGCAGCGGTGACGGCGCCGCCTGCTCTTGAGAGCCGATGCAACCGACCAGTACCGTGCCACACTCATAGCAGTCAGGAAAAACACACTTGCGTACATATTCATCGCTGTCACGTAAGACACTATCTTGCACATG

Function


symbol description
rxfp3 Predicted to enable G protein-coupled peptide receptor activity. Predicted to be involved in neuropeptide signaling pathway. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be integral component of plasma membrane. Is expressed in female organism; hindbrain; interrenal primordium; and male organism. Orthologous to human RXFP3 (relaxin family peptide receptor 3).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1191310 True 280 lncRNA 0.53 1 18933704 18933983

Neighbor


gene id symbol gene type direction distance location
LOC110537130 LOC106568157 coding downstream 26327 18833119 ~ 18907377 (-)
fgf10a LOC106568156 coding downstream 187125 18723193 ~ 18746579 (-)
ccdc80l2 LOC106568154 coding downstream 367612 18560756 ~ 18566092 (-)
LOC118937637 LOC106611709 coding downstream 375693 18545785 ~ 18558011 (-)
LOC110537126 fyb coding downstream 395079 18513211 ~ 18538625 (-)
LOC110536808 NA coding upstream 4235 18938218 ~ 18949907 (-)
LOC110536809 amacr coding upstream 37432 18971415 ~ 18994913 (-)
LOC110539127 LOC106568258 coding upstream 110141 19044124 ~ 19050623 (-)
LOC110536810 LOC106568158 coding upstream 132050 19066033 ~ 19077328 (-)
LOC110537133 LOC106563626 coding upstream 145671 19079654 ~ 19085444 (-)
G1045363 LOC106568242 non-coding downstream 105 18933207 ~ 18933599 (-)
G1045360 NA non-coding downstream 2437 18930894 ~ 18931267 (-)
G1045351 NA non-coding downstream 19937 18913080 ~ 18913767 (-)
G1045314 NA non-coding downstream 26820 18865333 ~ 18906884 (-)
G1045330 NA non-coding downstream 51784 18881134 ~ 18881920 (-)
G1045365 NA non-coding upstream 38 18934021 ~ 18934229 (-)
G1045407 NA non-coding upstream 25276 18959259 ~ 18959575 (-)
G1045426 NA non-coding upstream 38310 18972293 ~ 18972547 (-)
G1045427 NA non-coding upstream 40406 18974389 ~ 18974626 (-)
G1045429 NA non-coding upstream 43634 18977617 ~ 18977853 (-)
G1045201 NA other downstream 118310 18813902 ~ 18815394 (-)
LOC110537121 LOC106568150 other downstream 486453 18439759 ~ 18458056 (-)
G1044761 NA other downstream 740481 18192234 ~ 18193223 (-)
G1044692 NA other downstream 833982 18097563 ~ 18099722 (-)
LOC110537144 LOC106568168 other upstream 622295 19550953 ~ 19569458 (-)
LOC110536814 LOC106568181 other upstream 979856 19893417 ~ 19938584 (-)
G1047325 NA other upstream 1561582 20495565 ~ 20496428 (-)
LOC110537156 LOC106568185 other upstream 1575633 20488123 ~ 20599476 (-)
G1047473 NA other upstream 1767557 20701540 ~ 20702040 (-)

Expression



Co-expression Network