G1048273



Basic Information


Item Value
gene id G1048273
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 21614246 ~ 21614728 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1194603
AATTTGCGGAAGTTAACTTGATTACACTGTGAACATCATTAGGCCTTTTTACGAAAGTCAAGATGTTCTGATAATAACAACTAGTCTCTGTTATTTCCTCCATATGATCTATTTACTTTGTCAACAACCTCAAATTAAATCTGGAGGCTCCAAAACTGAAATTGAACTCATGAGGTCATATGAAGCAGATTACAGTATTGTGGCATTTTGCTAGGTTGTTAATCAACTGAGGGATTCCAGGAATAGCTGTAAATAAGGTCTTTACATTTGCAACACCAAAGGAACCTCATGATGGTTTACCACAGCTGAATTTCAGCTGAGTTCAGACCCAGTAAATCAACAATTTGATGTAGCAATTGAGTCTGCTCGTTTTGATTCGTCTTTATTTGATGCCATTAGTCCATAATCAGGTGGTTTCACAGCGTCCATATGACTTTGCAAAGAACATCAAGTTTAAAGATGAGAAATACACAGAACATCATA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1194603 True 483 lncRNA 0.36 1 21614246 21614728
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536816 myhz2 coding upstream 97430 21510489 ~ 21516816 (+)
LOC110537175 LOC106568200 coding upstream 133130 21464547 ~ 21481116 (+)
LOC110537171 LOC106568197 coding upstream 315843 21289084 ~ 21298403 (+)
LOC110537168 LOC106568260 coding upstream 649779 20961503 ~ 20964467 (+)
LOC110537167 LOC106568193 coding upstream 680380 20932536 ~ 20933866 (+)
foxred1 foxred1 coding downstream 13569 21628297 ~ 21643733 (+)
LOC110537183 LOC105014907 coding downstream 40664 21655392 ~ 21666107 (+)
LOC110537185 LOC106568207 coding downstream 70630 21685358 ~ 21692839 (+)
LOC110537186 LOC106568203 coding downstream 84034 21698762 ~ 21722433 (+)
LOC110537187 LOC106568201 coding downstream 115578 21730306 ~ 21752514 (+)
G1048325 NA non-coding upstream 19819 21594115 ~ 21594427 (+)
G1048259 NA non-coding upstream 108887 21505083 ~ 21505359 (+)
G1048257 NA non-coding upstream 111590 21502252 ~ 21502656 (+)
G1048256 NA non-coding upstream 120481 21493536 ~ 21493765 (+)
G1048253 NA non-coding upstream 122226 21491807 ~ 21492020 (+)
G1048275 NA non-coding downstream 11900 21626628 ~ 21626969 (+)
G1048350 NA non-coding downstream 59814 21674542 ~ 21674800 (+)
G1048363 NA non-coding downstream 87390 21702118 ~ 21702698 (+)
G1048382 NA non-coding downstream 102038 21716766 ~ 21716988 (+)
G1048384 NA non-coding downstream 104364 21719092 ~ 21719316 (+)
LOC110537158 LOC106568186 other upstream 922504 20667957 ~ 20694090 (+)
G1046929 NA other upstream 1102727 20509269 ~ 20511519 (+)
G1046823 NA other upstream 1320395 20282886 ~ 20293851 (+)
G1046724 NA other upstream 1466832 20144179 ~ 20147414 (+)
G1045418 NA other upstream 2648304 18965568 ~ 18965942 (+)
G1048417 LOC106568221 other downstream 218366 21833094 ~ 21834812 (+)
G1049502 NA other downstream 911213 22525941 ~ 22526232 (+)
G1049629 LOC106456187 other downstream 1114202 22728930 ~ 22737666 (+)
G1051534 NA other downstream 2562702 24177430 ~ 24177934 (+)
LOC110537258 msi2h other downstream 3737856 25352530 ~ 25719607 (+)

Expression


G1048273 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1048273 Expression in each Bioproject

Bar chart with 19 bars.
G1048273 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network