G1050523



Basic Information


Item Value
gene id G1050523
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 23373409 ~ 23373622 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1197105
tcattgtcctgttgaaaaacaaatgatagtcccactttgcccaaaccagatgggacgttgtatcgctgcagaatgttgtggtagccatgctggttaggtgtgccttgaattctaaataaaccacatacagtgtcaccagcaaagtacccccacaccataacacctcctacaccatgctttacagtgggaaatacacagagatcatccgttcacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1197105 True 214 lncRNA 0.45 1 23373409 23373622
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537227 LOC106568097 coding downstream 491485 22879185 ~ 22881924 (-)
LOC110537225 LOC106568098 coding downstream 503441 22862262 ~ 22869968 (-)
LOC110537224 LOC106568099 coding downstream 513776 22823888 ~ 22859633 (-)
LOC118937814 NA coding downstream 576676 22792108 ~ 22796733 (-)
LOC110537223 LOC106568102 coding downstream 593923 22769883 ~ 22779486 (-)
LOC118937815 LOC106568112 coding upstream 64096 23437718 ~ 23438711 (-)
LOC118937816 LOC106568112 coding upstream 79855 23453477 ~ 23454855 (-)
LOC110536822 LOC106568111 coding upstream 83961 23457583 ~ 23460327 (-)
LOC110537230 LOC106568094 coding upstream 345476 23719098 ~ 23951744 (-)
LOC110537232 LOC106568092 coding upstream 651752 24025374 ~ 24046364 (-)
G1050513 NA non-coding downstream 5256 23367944 ~ 23368153 (-)
G1050509 NA non-coding downstream 15234 23357956 ~ 23358175 (-)
G1050505 NA non-coding downstream 20550 23352647 ~ 23352859 (-)
G1050504 NA non-coding downstream 24946 23348123 ~ 23348463 (-)
G1050503 NA non-coding downstream 25981 23346828 ~ 23347428 (-)
G1050532 NA non-coding upstream 3324 23376946 ~ 23377220 (-)
G1050552 NA non-coding upstream 18497 23392119 ~ 23392379 (-)
G1050554 NA non-coding upstream 20151 23393773 ~ 23393995 (-)
G1050556 NA non-coding upstream 22174 23395796 ~ 23395997 (-)
G1050657 NA non-coding upstream 108356 23481978 ~ 23482237 (-)
G1050429 NA other downstream 129139 23243637 ~ 23244270 (-)
G1049722 NA other downstream 683812 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 731810 22607858 ~ 22654480 (-)
LOC110537218 LOC106568105 other downstream 826752 22540032 ~ 22546807 (-)
G1049389 NA other downstream 1032900 22337086 ~ 22340509 (-)
G1052040 acaca other upstream 1181075 24554697 ~ 24555000 (-)
LOC118936414 NA other upstream 1230658 24600309 ~ 24607820 (-)
G1054211 NA other upstream 2250257 25623879 ~ 25624637 (-)
G1054232 NA other upstream 2283647 25657269 ~ 25659005 (-)
G1055010 NA other upstream 3607161 26980783 ~ 26982355 (-)

Expression


G1050523 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1050523 Expression in each Bioproject

Bar chart with 11 bars.
G1050523 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network