G1051342


Basic Information

Item Value
gene id G1051342
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 23864030 ~ 23865163 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1198001
CAACCGGTCAAAAGGGCTGACCAACCGGTCAAAAGGGCTGACCAACCGTTCAAAAGGGCTGACCAACCGGTCAAAGGGGCTGACCAACCGGTCAAAAGGGCTGACCAACCTGTCAAAGGGGCTGACCAACTGGTCAAAAGACCTGACCAACTGGTCAAAAGGGCTGACCAACCGGTCAAAAGGGCTGACCAACCGGTCAAAGGGGCTGACCAACCGGTCAAAAGGGCTGACCAACCGGTCAAAAGGGCTGACCAACTGGTCAAAAGGGCTGACCAACTGGTCAAAAGACCTGACCAACTGGTCAAAAGACCTGACCAACTGGTCAAAAGACCTGACCAACCTGTCAAAGGGGCTGACCAACCGGTCAAAAGACCTGACCAACTGGTCAAAAGACCTGACCAACTGGTCAAAAGGGCTGACCAACTGGTCAAAAGAGCTGACCATCCCGTCAAAGGGGCTGACCGACCGGTCAAAAGACCTGACCAACTGGTCAAAAGACTTGACCAACTGGTCAAAAGACCTGACCAACCGGTCAAAAGACCTGAC

Function

NR:

description
PREDICTED: coiled-coil domain-containing protein 70-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1198001 True 546 lncRNA 0.53 2 23864030 23865163
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110536822 LOC106568111 coding downstream 403703 23457583 ~ 23460327 (-)
LOC118937816 LOC106568112 coding downstream 409175 23453477 ~ 23454855 (-)
LOC118937815 LOC106568112 coding downstream 425319 23437718 ~ 23438711 (-)
LOC110537227 LOC106568097 coding downstream 982106 22879185 ~ 22881924 (-)
LOC110537225 LOC106568098 coding downstream 994062 22862262 ~ 22869968 (-)
LOC110537232 LOC106568092 coding upstream 160211 24025374 ~ 24046364 (-)
LOC110537233 LOC106568122 coding upstream 184711 24049874 ~ 24058463 (-)
LOC110537234 LOC106568091 coding upstream 197310 24062473 ~ 24090094 (-)
LOC110537235 LOC106568090 coding upstream 230317 24095480 ~ 24122061 (-)
LOC118936414 NA coding upstream 735146 24600309 ~ 24607820 (-)
G1051317 NA non-coding downstream 26698 23814084 ~ 23837332 (-)
G1051273 NA non-coding downstream 42049 23739906 ~ 23821981 (-)
G1051311 NA non-coding downstream 55434 23808236 ~ 23808596 (-)
G1050657 NA non-coding downstream 381793 23481978 ~ 23482237 (-)
G1050556 NA non-coding downstream 468033 23395796 ~ 23395997 (-)
G1051416 NA non-coding upstream 157930 24023093 ~ 24024320 (-)
G1051459 NA non-coding upstream 171912 24037075 ~ 24070281 (-)
G1051475 NA non-coding upstream 213247 24078410 ~ 24083559 (-)
G1051571 NA non-coding upstream 341397 24206560 ~ 24206833 (-)
G1051622 NA non-coding upstream 373509 24238672 ~ 24238971 (-)
G1050429 NA other downstream 619760 23243637 ~ 23244270 (-)
G1049722 NA other downstream 1174433 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 1222431 22607858 ~ 22654480 (-)
LOC110537218 LOC106568105 other downstream 1317373 22540032 ~ 22546807 (-)
G1049389 NA other downstream 1523521 22337086 ~ 22340509 (-)
G1052040 acaca other upstream 689534 24554697 ~ 24555000 (-)
G1054211 NA other upstream 1758716 25623879 ~ 25624637 (-)
G1054232 NA other upstream 1792106 25657269 ~ 25659005 (-)
G1055010 NA other upstream 3115620 26980783 ~ 26982355 (-)

Expression

G1051342 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1051342 Expression in each Bioproject

Bar chart with 15 bars.
G1051342 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network