G1051646



Basic Information


Item Value
gene id G1051646
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 24256299 ~ 24256498 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1198322
gtggaaggctacccaaaacgtttgacccaagttaaataatttaaaggcaatgctaccaaatactaattgagtgtatgtaaacttctgacccactgagaatgtgatgaaataaataaaagctgaaataaatcattctctctacgattattctgacatctcacattcttaaaataaagtggtgatcctaactgaccaaagac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1198322 True 200 lncRNA 0.34 1 24256299 24256498
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537235 LOC106568090 coding downstream 134238 24095480 ~ 24122061 (-)
LOC110537234 LOC106568091 coding downstream 166205 24062473 ~ 24090094 (-)
LOC110537233 LOC106568122 coding downstream 197836 24049874 ~ 24058463 (-)
LOC110537232 LOC106568092 coding downstream 209935 24025374 ~ 24046364 (-)
LOC110537230 LOC106568094 coding downstream 304555 23719098 ~ 23951744 (-)
LOC118936414 NA coding upstream 343811 24600309 ~ 24607820 (-)
LOC110537239 aatf coding upstream 351748 24608246 ~ 24617116 (-)
LOC110537240 lhx1 coding upstream 360685 24617118 ~ 24623412 (-)
mrm1 mrm1 coding upstream 463886 24720384 ~ 24725396 (-)
LOC110536825 LOC106603276 coding upstream 471501 24727999 ~ 24730374 (-)
G1051622 NA non-coding downstream 17328 24238672 ~ 24238971 (-)
G1051571 NA non-coding downstream 49466 24206560 ~ 24206833 (-)
G1051475 NA non-coding downstream 172740 24078410 ~ 24083559 (-)
G1051459 NA non-coding downstream 186018 24037075 ~ 24070281 (-)
G1051416 NA non-coding downstream 231979 24023093 ~ 24024320 (-)
G1051652 NA non-coding upstream 4468 24260966 ~ 24261188 (-)
G1051654 NA non-coding upstream 5392 24261890 ~ 24262095 (-)
G1051666 NA non-coding upstream 13397 24269895 ~ 24270339 (-)
G1051912 NA non-coding upstream 133985 24390483 ~ 24427580 (-)
G1051923 LOC106568088 non-coding upstream 151927 24408425 ~ 24409972 (-)
G1050429 NA other downstream 1012029 23243637 ~ 23244270 (-)
G1049722 NA other downstream 1566702 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 1614700 22607858 ~ 22654480 (-)
LOC110537218 LOC106568105 other downstream 1709642 22540032 ~ 22546807 (-)
G1049389 NA other downstream 1915790 22337086 ~ 22340509 (-)
G1052040 acaca other upstream 298199 24554697 ~ 24555000 (-)
G1054211 NA other upstream 1367381 25623879 ~ 25624637 (-)
G1054232 NA other upstream 1400771 25657269 ~ 25659005 (-)
G1055010 NA other upstream 2724285 26980783 ~ 26982355 (-)

Expression


G1051646 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1051646 Expression in each Bioproject

Bar chart with 15 bars.
G1051646 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network