G1052038



Basic Information


Item Value
gene id G1052038
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 24553419 ~ 24553630 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1198733
CCCTCTCCATGTCCTCAAAAACGGCTGAGGTGGAGATGGTGGCGGGAGCCTCTTCTATGATCTTCTGGTGTCGCCGCTGTACGGAGCAGTCCCTGCCGAACAGGGAGATGGCGTTGCCGTACTGGTCAGCCAGGAGCTGGACCTCCAGGTGACGAGCGTGTTTGGCCAGCTGCATCACAAAGATGGGTGAGCCTGGAACCTCAGTCTGGACC

Function


NR:

description
acetyl-CoA carboxylase-like isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1198733 True 212 lncRNA 0.60 1 24553419 24553630

Neighbor


gene id symbol gene type direction distance location
LOC110537235 LOC106568090 coding downstream 431358 24095480 ~ 24122061 (-)
LOC110537234 LOC106568091 coding downstream 463325 24062473 ~ 24090094 (-)
LOC110537233 LOC106568122 coding downstream 494956 24049874 ~ 24058463 (-)
LOC110537232 LOC106568092 coding downstream 507055 24025374 ~ 24046364 (-)
LOC110537230 LOC106568094 coding downstream 601675 23719098 ~ 23951744 (-)
LOC118936414 NA coding upstream 46679 24600309 ~ 24607820 (-)
LOC110537239 aatf coding upstream 54616 24608246 ~ 24617116 (-)
LOC110537240 lhx1 coding upstream 63553 24617118 ~ 24623412 (-)
mrm1 mrm1 coding upstream 166754 24720384 ~ 24725396 (-)
LOC110536825 LOC106603276 coding upstream 174369 24727999 ~ 24730374 (-)
G1052025 NA non-coding downstream 20983 24532112 ~ 24532436 (-)
G1052024 NA non-coding downstream 21710 24531479 ~ 24531709 (-)
G1051936 NA non-coding downstream 121106 24432038 ~ 24432313 (-)
G1051934 NA non-coding downstream 123344 24429721 ~ 24430075 (-)
G1051912 NA non-coding downstream 125839 24390483 ~ 24427580 (-)
G1052039 NA non-coding upstream 14 24553644 ~ 24553933 (-)
G1052041 LOC104950802 non-coding upstream 1508 24555138 ~ 24555382 (-)
G1052054 NA non-coding upstream 17174 24570804 ~ 24571020 (-)
G1052073 NA non-coding upstream 36300 24589930 ~ 24592772 (-)
G1052080 NA non-coding upstream 44237 24597867 ~ 24598128 (-)
G1050429 NA other downstream 1309149 23243637 ~ 23244270 (-)
G1049722 NA other downstream 1863822 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 1911820 22607858 ~ 22654480 (-)
LOC110537218 LOC106568105 other downstream 2006762 22540032 ~ 22546807 (-)
G1049389 NA other downstream 2212910 22337086 ~ 22340509 (-)
G1052040 acaca other upstream 1067 24554697 ~ 24555000 (-)
G1054211 NA other upstream 1070249 25623879 ~ 25624637 (-)
G1054232 NA other upstream 1103639 25657269 ~ 25659005 (-)
G1055010 NA other upstream 2427153 26980783 ~ 26982355 (-)

Expression


G1052038 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1052038 Expression in each Bioproject

Bar chart with 4 bars.
G1052038 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network