G1052039



Basic Information


Item Value
gene id G1052039
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 24553644 ~ 24553933 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1198734
GCTGTGCAGCAGGCAGGTTGACGTCGGCCACCATCTCAGTACAGGGGTGTTCCACCTGCAGACGAGGGTTGAGTTCTAGGAAGTAGAAGCTGCCATCTTGGCTGTAGAGATACTCCACTGTGCCAGCACTGACGTAGCCCACCATCTTAGCCAGCTTCACTGCACACTGAGGAGTGAGGAATAGACACTCAGTCACAACCCGGCAACTTAACCACAGGTCAACAAGTCCCTCTGGTCATAGTCTCTCTCAAATGAAACATATTGGAATAGCTCTTCCCATTCAATAGCAC

Function


NR:

description
acetyl-CoA carboxylase 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1198734 True 290 lncRNA 0.51 1 24553644 24553933
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537235 LOC106568090 coding downstream 431583 24095480 ~ 24122061 (-)
LOC110537234 LOC106568091 coding downstream 463550 24062473 ~ 24090094 (-)
LOC110537233 LOC106568122 coding downstream 495181 24049874 ~ 24058463 (-)
LOC110537232 LOC106568092 coding downstream 507280 24025374 ~ 24046364 (-)
LOC110537230 LOC106568094 coding downstream 601900 23719098 ~ 23951744 (-)
LOC118936414 NA coding upstream 46376 24600309 ~ 24607820 (-)
LOC110537239 aatf coding upstream 54313 24608246 ~ 24617116 (-)
LOC110537240 lhx1 coding upstream 63250 24617118 ~ 24623412 (-)
mrm1 mrm1 coding upstream 166451 24720384 ~ 24725396 (-)
LOC110536825 LOC106603276 coding upstream 174066 24727999 ~ 24730374 (-)
G1052038 NA non-coding downstream 14 24553419 ~ 24553630 (-)
G1052025 NA non-coding downstream 21208 24532112 ~ 24532436 (-)
G1052024 NA non-coding downstream 21935 24531479 ~ 24531709 (-)
G1051936 NA non-coding downstream 121331 24432038 ~ 24432313 (-)
G1051934 NA non-coding downstream 123569 24429721 ~ 24430075 (-)
G1052041 LOC104950802 non-coding upstream 1205 24555138 ~ 24555382 (-)
G1052054 NA non-coding upstream 16871 24570804 ~ 24571020 (-)
G1052073 NA non-coding upstream 35997 24589930 ~ 24592772 (-)
G1052080 NA non-coding upstream 43934 24597867 ~ 24598128 (-)
G1050429 NA other downstream 1309374 23243637 ~ 23244270 (-)
G1049722 NA other downstream 1864047 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 1912045 22607858 ~ 22654480 (-)
LOC110537218 LOC106568105 other downstream 2006987 22540032 ~ 22546807 (-)
G1049389 NA other downstream 2213135 22337086 ~ 22340509 (-)
G1052040 acaca other upstream 764 24554697 ~ 24555000 (-)
G1054211 NA other upstream 1069946 25623879 ~ 25624637 (-)
G1054232 NA other upstream 1103336 25657269 ~ 25659005 (-)
G1055010 NA other upstream 2426850 26980783 ~ 26982355 (-)

Expression


G1052039 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1052039 Expression in each Bioproject

Bar chart with 8 bars.
G1052039 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network