G1052040 (acaca)



Basic Information


Item Value
gene id G1052040
gene name acaca
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 24554697 ~ 24555000 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1198735
CTCTCGGTTCTCACCCCAGGAGAAGCAGTGGCCAAACTGGGAGTCTGCAAACTCATGCAGGCCTCCGGCCGCGGCCACACTGAAGTATCCCCACACATTCTTGTTACTGCGGAAGTTCAGCTCCTGCACCGTGCCCGAGCTCGGCTTGAAACCCTCATCCGGGTTCTCACTGGTGATGCGGGCAGCGATGACATGCCCACGTGGGGAGGGGGCCGTGGACAGACCCTCAAAGTCAATCATAGAGTCTCCCCAGGGCTGGACCCCATACATCATTCTGATGTCCTTAATACGGTGCAGGGGGATC

Function


symbol description
acaca Predicted to enable ATP binding activity; acetyl-CoA carboxylase activity; and metal ion binding activity. Acts upstream of or within response to (R)-carnitine. Is expressed in liver and male organism. Orthologous to human ACACA (acetyl-CoA carboxylase alpha).

NR:

description
acetyl-CoA carboxylase-like isoform X7

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1198735 True 304 TUCP 0.59 1 24554697 24555000
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537235 LOC106568090 coding downstream 432636 24095480 ~ 24122061 (-)
LOC110537234 LOC106568091 coding downstream 464603 24062473 ~ 24090094 (-)
LOC110537233 LOC106568122 coding downstream 496234 24049874 ~ 24058463 (-)
LOC110537232 LOC106568092 coding downstream 508333 24025374 ~ 24046364 (-)
LOC110537230 LOC106568094 coding downstream 602953 23719098 ~ 23951744 (-)
LOC118936414 NA coding upstream 45309 24600309 ~ 24607820 (-)
LOC110537239 aatf coding upstream 53246 24608246 ~ 24617116 (-)
LOC110537240 lhx1 coding upstream 62183 24617118 ~ 24623412 (-)
mrm1 mrm1 coding upstream 165384 24720384 ~ 24725396 (-)
LOC110536825 LOC106603276 coding upstream 172999 24727999 ~ 24730374 (-)
G1052039 NA non-coding downstream 764 24553644 ~ 24553933 (-)
G1052038 NA non-coding downstream 1067 24553419 ~ 24553630 (-)
G1052025 NA non-coding downstream 22261 24532112 ~ 24532436 (-)
G1052024 NA non-coding downstream 22988 24531479 ~ 24531709 (-)
G1051936 NA non-coding downstream 122384 24432038 ~ 24432313 (-)
G1052041 LOC104950802 non-coding upstream 138 24555138 ~ 24555382 (-)
G1052054 NA non-coding upstream 15804 24570804 ~ 24571020 (-)
G1052073 NA non-coding upstream 34930 24589930 ~ 24592772 (-)
G1052080 NA non-coding upstream 42867 24597867 ~ 24598128 (-)
G1050429 NA other downstream 1310427 23243637 ~ 23244270 (-)
G1049722 NA other downstream 1865100 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 1913098 22607858 ~ 22654480 (-)
LOC110537218 LOC106568105 other downstream 2008040 22540032 ~ 22546807 (-)
G1049389 NA other downstream 2214188 22337086 ~ 22340509 (-)
G1054211 NA other upstream 1068879 25623879 ~ 25624637 (-)
G1054232 NA other upstream 1102269 25657269 ~ 25659005 (-)
G1055010 NA other upstream 2425783 26980783 ~ 26982355 (-)
G1055199 NA other upstream 2590210 27145210 ~ 27145493 (-)

Expression


G1052040(acaca) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1052040(acaca) Expression in each Bioproject

Bar chart with 4 bars.
G1052040(acaca) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network