G1052080



Basic Information


Item Value
gene id G1052080
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 24597867 ~ 24598128 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1198777
gcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaataaaatccacctgtgtgtaatcaggtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaaaaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatttggatacaaaaagatttcccaagctttaaac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU1198777 True 262 lncRNA 0.42 1 24597867 24598128
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537235 LOC106568090 coding downstream 475806 24095480 ~ 24122061 (-)
LOC110537234 LOC106568091 coding downstream 507773 24062473 ~ 24090094 (-)
LOC110537233 LOC106568122 coding downstream 539404 24049874 ~ 24058463 (-)
LOC110537232 LOC106568092 coding downstream 551503 24025374 ~ 24046364 (-)
LOC110537230 LOC106568094 coding downstream 646123 23719098 ~ 23951744 (-)
LOC118936414 NA coding upstream 2181 24600309 ~ 24607820 (-)
LOC110537239 aatf coding upstream 10118 24608246 ~ 24617116 (-)
LOC110537240 lhx1 coding upstream 19055 24617118 ~ 24623412 (-)
mrm1 mrm1 coding upstream 122256 24720384 ~ 24725396 (-)
LOC110536825 LOC106603276 coding upstream 129871 24727999 ~ 24730374 (-)
G1052073 NA non-coding downstream 5095 24589930 ~ 24592772 (-)
G1052054 NA non-coding downstream 26847 24570804 ~ 24571020 (-)
G1052041 LOC104950802 non-coding downstream 42485 24555138 ~ 24555382 (-)
G1052039 NA non-coding downstream 43934 24553644 ~ 24553933 (-)
G1052038 NA non-coding downstream 44237 24553419 ~ 24553630 (-)
G1052113 NA non-coding upstream 32609 24630737 ~ 24633618 (-)
G1052118 NA non-coding upstream 37649 24635777 ~ 24636076 (-)
G1052040 acaca other downstream 42867 24554697 ~ 24555000 (-)
G1050429 NA other downstream 1353597 23243637 ~ 23244270 (-)
G1049722 NA other downstream 1908270 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 1956268 22607858 ~ 22654480 (-)
LOC110537218 LOC106568105 other downstream 2051210 22540032 ~ 22546807 (-)
G1054211 NA other upstream 1025751 25623879 ~ 25624637 (-)
G1054232 NA other upstream 1059141 25657269 ~ 25659005 (-)
G1055010 NA other upstream 2382655 26980783 ~ 26982355 (-)
G1055199 NA other upstream 2547082 27145210 ~ 27145493 (-)

Expression


G1052080 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1052080 Expression in each Bioproject

Bar chart with 14 bars.
G1052080 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network