G1053878



Basic Information


Item Value
gene id G1053878
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 25134802 ~ 25135251 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1200741
TCTCATCTTAAATCACTGGGTGCTGACATAGTGTTTCTTCAAGAAACTCATCTTAAATCACTGGGTGCTGACATAGTGTTTCTTCAAGAAACTCATCTTAAATCACTGGGTGCTGACATAGTGCTTCTTCAAGAAACTCATCTTAAATCACTGGGTGCTGACATAGTGTTTCTTCAAGAAACTCATCTTAAATCACTGGGTGCTGACATAGTGTTTCTTCAAGAAACTCATCTTAAATCACTGGGTGCTGACATAGTGCTTCTTCAAGAAACTCATCTTAAATCACTGGGTGCTGACATAGTGTTTCTTCAAGAAACTCATGTTAAACGCTCCGCTCAGGCCAAGCTACGAGTCGGCTGG

Function


NR:

description
PREDICTED: uncharacterized protein LOC106587672

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1200741 True 360 lncRNA 0.41 3 25134802 25135251

Neighbor


gene id symbol gene type direction distance location
LOC110537244 LOC106568079 coding downstream 155845 24751606 ~ 24978957 (-)
LOC110537242 LOC106568081 coding downstream 387803 24737872 ~ 24746999 (-)
LOC100301685 rdh12 coding downstream 397703 24734911 ~ 24737099 (-)
LOC110536825 LOC106603276 coding downstream 404428 24727999 ~ 24730374 (-)
mrm1 mrm1 coding downstream 409406 24720384 ~ 24725396 (-)
LOC110536826 LOC106568076 coding upstream 11938 25147189 ~ 25151399 (-)
LOC110537255 NA coding upstream 156769 25292020 ~ 25292876 (-)
LOC110537253 LOC106567760 coding upstream 158153 25293404 ~ 25296817 (-)
LOC110537254 LOC106567761 coding upstream 162278 25297529 ~ 25300040 (-)
LOC110537261 LOC106567765 coding upstream 656113 25791364 ~ 25797619 (-)
G1053824 NA non-coding downstream 84951 25049453 ~ 25049851 (-)
G1053818 NA non-coding downstream 89658 25044872 ~ 25045144 (-)
G1053817 NA non-coding downstream 90156 25044185 ~ 25044646 (-)
G1053815 NA non-coding downstream 94427 25040098 ~ 25040375 (-)
LOC110537246 LOC106568078 non-coding downstream 96208 25036828 ~ 25142397 (-)
G1053906 NA non-coding upstream 39731 25174982 ~ 25175209 (-)
G1053908 NA non-coding upstream 40327 25175578 ~ 25175990 (-)
G1053909 NA non-coding upstream 43579 25178830 ~ 25179239 (-)
G1053914 NA non-coding upstream 57556 25192807 ~ 25196054 (-)
G1053939 lgals9 non-coding upstream 103588 25238839 ~ 25248756 (-)
LOC118936414 NA other downstream 526982 24600309 ~ 24607820 (-)
G1052040 acaca other downstream 579802 24554697 ~ 24555000 (-)
G1050429 NA other downstream 1890532 23243637 ~ 23244270 (-)
G1049722 NA other downstream 2445205 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 2493203 22607858 ~ 22654480 (-)
G1054211 NA other upstream 488628 25623879 ~ 25624637 (-)
G1054232 NA other upstream 522018 25657269 ~ 25659005 (-)
G1055010 NA other upstream 1845532 26980783 ~ 26982355 (-)
G1055199 NA other upstream 2009959 27145210 ~ 27145493 (-)
G1056225 NA other upstream 2842775 27978026 ~ 27978436 (-)

Expression


G1053878 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1053878 Expression in each Bioproject

Bar chart with 14 bars.
G1053878 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network