G1054211



Basic Information


Item Value
gene id G1054211
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 25623879 ~ 25624637 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1201112
CTATAAGACTATGGTTTCACTACAAGACTGTGGTTCCACTACAAGACTATGGTTTCACTACAAGACTGTGGTTCCACTACAAGACTGTGGTTCCACTACAATACTGTGGTTTCACTACAAGACCGTGGTTCCACCACAAGACTATGGTTTCACTACAAGACTATGGTTCCACTACAAGACTACGGTTCCACTACAAGACTACATTTCCACTACAACACTACGGTTCCACTACAAGACTATGGTTTCACTATGAGACGTACCATCCCACAACTGTTCTACTATGATTCTACTACACTAAGATGTTCCTTACCAACCAGGAACCCTCTCCATGAGGAAGTGTGGTGGAATGACTAATGGTTATGTGATAAGCTACCCAATCAGCACCGCCTCTACCAATTGACAGCATAAATAAACATAATGCATAGAACAGGTGTTAGTCTGTAGCACACACCACCACGTGGCGATATACAAGGCCACCTGAAGATATATCTAGAGAGATGAGGTGAGACCTTATTGTCATTCAGCCTCCGTCTCCTGGCCGCCTCGTAGATGGGGGCGAGGCAGTTGGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1201112 True 569 TUCP 0.45 2 25623879 25624637
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537254 LOC106567761 coding downstream 323839 25297529 ~ 25300040 (-)
LOC110537253 LOC106567760 coding downstream 327062 25293404 ~ 25296817 (-)
LOC110537255 NA coding downstream 331003 25292020 ~ 25292876 (-)
LOC110536826 LOC106568076 coding downstream 472480 25147189 ~ 25151399 (-)
LOC110537246 LOC106568078 coding downstream 481482 25036828 ~ 25142397 (-)
LOC110537261 LOC106567765 coding upstream 166727 25791364 ~ 25797619 (-)
LOC110536828 LOC106568049 coding upstream 217455 25842092 ~ 25854283 (-)
aifm1 aifm1 coding upstream 229692 25854329 ~ 25872194 (-)
LOC110537265 LOC106567767 coding upstream 251819 25876456 ~ 25881436 (-)
zgc:113208 LOC106567768 coding upstream 261308 25885945 ~ 25889799 (-)
G1054135 NA non-coding downstream 107778 25515655 ~ 25516101 (-)
G1054078 NA non-coding downstream 171942 25451137 ~ 25451937 (-)
G1054001 NA non-coding downstream 285048 25337802 ~ 25338831 (-)
G1053991 NA non-coding downstream 302806 25320867 ~ 25321073 (-)
G1053988 NA non-coding downstream 303840 25316757 ~ 25320039 (-)
G1054224 NA non-coding upstream 19259 25643896 ~ 25644910 (-)
G1054231 NA non-coding upstream 32293 25656930 ~ 25657479 (-)
G1054233 NA non-coding upstream 33011 25657648 ~ 25658035 (-)
G1054319 NA non-coding upstream 179802 25804439 ~ 25804695 (-)
LOC118936414 NA other downstream 1016059 24600309 ~ 24607820 (-)
G1052040 acaca other downstream 1068879 24554697 ~ 24555000 (-)
G1050429 NA other downstream 2379609 23243637 ~ 23244270 (-)
G1049722 NA other downstream 2934282 22689161 ~ 22689597 (-)
LOC110536820 LOC106603249 other downstream 2982280 22607858 ~ 22654480 (-)
G1054232 NA other upstream 32632 25657269 ~ 25659005 (-)
G1055010 NA other upstream 1356146 26980783 ~ 26982355 (-)
G1055199 NA other upstream 1520573 27145210 ~ 27145493 (-)
G1056225 NA other upstream 2353389 27978026 ~ 27978436 (-)
G1057449 LOC106567827 other upstream 2551749 28176386 ~ 28177073 (-)

Expression


G1054211 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1054211 Expression in each Bioproject

Bar chart with 11 bars.
G1054211 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network