G1054224



Basic Information


Item Value
gene id G1054224
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 25643896 ~ 25644910 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1201127
ggtaattaacatagcaggttagtacttacacagcaggttatggtaattaacatagcaggttagtacttacacagcaggttatggtaattaacatagcaggttagaacttacacagcaggttatggtaattaacatagcaggttagaacttacacagcaggttatggtaattaacatagcaggttagaacttacacagcaggttatggtaattaacatagcaggttagtacttacacagcaggttatggtaattaacatagcaggttagaacttacacagcaggttatggtaattaacatagcaggttagtacttacacagcaggttatggtaattaacatagcaggttagtacttacacagcaggttatggtaattaacatagcaggttagtacttacacagcaggttatggtaattaacatagcagggtagaacttacacagcaggttatggtaattaacatagcagggtagaacttacac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1201127 True 482 lncRNA 0.37 3 25643896 25644910
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537254 LOC106567761 coding downstream 343856 25297529 ~ 25300040 (-)
LOC110537253 LOC106567760 coding downstream 347079 25293404 ~ 25296817 (-)
LOC110537255 NA coding downstream 351020 25292020 ~ 25292876 (-)
LOC110536826 LOC106568076 coding downstream 492497 25147189 ~ 25151399 (-)
LOC110537246 LOC106568078 coding downstream 501499 25036828 ~ 25142397 (-)
LOC110537261 LOC106567765 coding upstream 146454 25791364 ~ 25797619 (-)
LOC110536828 LOC106568049 coding upstream 197182 25842092 ~ 25854283 (-)
aifm1 aifm1 coding upstream 209419 25854329 ~ 25872194 (-)
LOC110537265 LOC106567767 coding upstream 231546 25876456 ~ 25881436 (-)
zgc:113208 LOC106567768 coding upstream 241035 25885945 ~ 25889799 (-)
G1054135 NA non-coding downstream 127795 25515655 ~ 25516101 (-)
G1054078 NA non-coding downstream 191959 25451137 ~ 25451937 (-)
G1054001 NA non-coding downstream 305065 25337802 ~ 25338831 (-)
G1053991 NA non-coding downstream 322823 25320867 ~ 25321073 (-)
G1053988 NA non-coding downstream 323857 25316757 ~ 25320039 (-)
G1054231 NA non-coding upstream 12020 25656930 ~ 25657479 (-)
G1054233 NA non-coding upstream 12738 25657648 ~ 25658035 (-)
G1054319 NA non-coding upstream 159529 25804439 ~ 25804695 (-)
G1054355 NA non-coding upstream 228544 25873454 ~ 25873669 (-)
G1054211 NA other downstream 19259 25623879 ~ 25624637 (-)
LOC118936414 NA other downstream 1036076 24600309 ~ 24607820 (-)
G1052040 acaca other downstream 1088896 24554697 ~ 24555000 (-)
G1050429 NA other downstream 2399626 23243637 ~ 23244270 (-)
G1049722 NA other downstream 2954299 22689161 ~ 22689597 (-)
G1054232 NA other upstream 12359 25657269 ~ 25659005 (-)
G1055010 NA other upstream 1335873 26980783 ~ 26982355 (-)
G1055199 NA other upstream 1500300 27145210 ~ 27145493 (-)
G1056225 NA other upstream 2333116 27978026 ~ 27978436 (-)
G1057449 LOC106567827 other upstream 2531476 28176386 ~ 28177073 (-)

Expression


G1054224 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1054224 Expression in each Bioproject

Bar chart with 9 bars.
G1054224 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network