G1056204



Basic Information


Item Value
gene id G1056204
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 27969274 ~ 27969484 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1203313
tttcaggtctctccaaagatgttcaatcaggttcaagtctgagctctggctgggccactcaaggacattcagagacttgtcccgaagccactcctgcattgtcttggctgtgtgcttagggtcgttgtcctgttggatggtgaaccttcaccccagtctgaggccctgagcactcctgagcaggttttcatcaaggatctctctgtacgtt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1203313 True 211 lncRNA 0.52 1 27969274 27969484
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537325 LOC106567818 coding upstream 111055 27850253 ~ 27858219 (+)
LOC110537324 LOC106567819 coding upstream 119356 27834303 ~ 27849918 (+)
LOC110539135 LOC106568036 coding upstream 152572 27812785 ~ 27816702 (+)
LOC110537321 LOC106567817 coding upstream 162466 27792240 ~ 27806808 (+)
LOC110537320 LOC106567815 coding upstream 179115 27785883 ~ 27790159 (+)
ucp2b ucp2b coding downstream 69717 28039201 ~ 28042491 (+)
rab6a rab6a coding downstream 92756 28062240 ~ 28088391 (+)
LOC110537331 LOC106567824 coding downstream 120939 28090423 ~ 28117403 (+)
LOC110537332 LOC106567825 coding downstream 180438 28149922 ~ 28162034 (+)
LOC110537334 LOC106567827 coding downstream 206608 28176092 ~ 28178670 (+)
G1056203 NA non-coding upstream 2837 27966224 ~ 27966437 (+)
G1055638 NA non-coding upstream 74242 27853405 ~ 27895032 (+)
G1055590 NA non-coding upstream 115311 27773353 ~ 27853963 (+)
G1055620 NA non-coding upstream 145039 27821858 ~ 27824235 (+)
G1055582 NA non-coding upstream 197264 27761938 ~ 27772010 (+)
G1056232 NA non-coding downstream 14457 27983941 ~ 27984148 (+)
G1056282 NA non-coding downstream 65957 28035441 ~ 28035643 (+)
G1056284 NA non-coding downstream 67790 28037274 ~ 28037492 (+)
G1056285 NA non-coding downstream 68812 28038296 ~ 28038698 (+)
G1056302 NA non-coding downstream 98764 28068248 ~ 28068481 (+)
LOC110537316 LOC106567813 other upstream 231741 27724763 ~ 27737547 (+)
LOC110536832 LOC106567811 other upstream 257555 27711313 ~ 27715011 (+)
hmgn7 LOC106567806 other upstream 396729 27569334 ~ 27572548 (+)
G1055498 LOC106568053 other upstream 406603 27561371 ~ 27562671 (+)
G1056324 NA other downstream 142769 28112253 ~ 28157057 (+)
rnf214 LOC106567832 other downstream 256220 28222935 ~ 28230419 (+)
LOC110537361 LOC106603379 other downstream 914456 28828372 ~ 28894230 (+)
G1056845 NA other downstream 1126588 29096072 ~ 29097636 (+)
LOC110537386 LOC106567871 other downstream 1729304 29698677 ~ 29726867 (+)

Expression


G1056204 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1056204 Expression in each Bioproject

Bar chart with 21 bars.
G1056204 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network