G1057448



Basic Information


Item Value
gene id G1057448
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 28178823 ~ 28180060 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1204715
acattcccagtgggtcagaagtttacatacactcaattagtatttggaagcattgcctttaaattgtttaacttgggtcaaacatttcaggtagccttccacaagcttcccacaatgagttgggtgaattttggcccattcctcctgacagagctggtgtaactgagtcaggtttgtaggcctccttgctcacatacgctctttcagttctgcccacaaattttctatgggattgaggtcagggcttgtgatggccactccaataccttgactttgttgtccttaagcaattttgccacaactttggaagtatgcttggggtcattgcccatttggaagaccaatttgcaaccaagctttaacttcctgactgatgtcttgagatgttgcttcaatatatccacataatgttccttcctcatgatgccatttattttgtgaaatgcaccagtccctcctgcagcaaagcacccccacaacatgacactgccacccccgtgcttcacggttgggatggtgctcttcggcttgcaagcctctccctttttcctccaaacataacgatggtcattatggccaaacagttctattttgtttcatcagaccagaggacatttctctaaaaagtacgatctttgtccccatgtgcagttgcaaaccgtagtctggctttttttatggcggttttggagcagtggcttctaccttgctgagcgtcctttcatgttatgttgatataggtctcgttttactttggatatagatacttttgtacctgattcctctccacaaggtcctttgctgttgttctgggattgagttgcacttttcgcaccgaagtacgttcaactctaggagacaaaactcgtctccttcctgagcggtatgacggctgcgcggtcccatggtgttcatacctgcgtaatattgtttgtacagatgaacgtggtaccttcaggcatttggaaattgcgccgaaggatgaaccagacttgtggaggtctacatgttttttttttctgaggtcttggcggatttcttttgattttcccatgatgtcaagcaaagagacactaagtttgaaggtaggccttgaaatacagccacaggtacacctctaattgactcaaatgatgtcaattagcctatcagaagcttctaaaaccatgacataattttctgggattttccaagctgtttaaaggcacggtcaacttagtgtatgtaaacttctgacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1204715 True 1238 lncRNA 0.44 1 28178823 28180060

Neighbor


gene id symbol gene type direction distance location
LOC110537333 LOC106567826 coding downstream 2821 28170969 ~ 28176002 (-)
LOC110536834 mrpl48 coding downstream 117004 28056959 ~ 28061819 (-)
dnajb13 dnajb13 coding downstream 122332 28042588 ~ 28056491 (-)
LOC110537327 ppme1 coding downstream 147901 28013959 ~ 28030922 (-)
trnav-uac-18 NA coding downstream 278383 27900367 ~ 27900440 (-)
LOC110537335 LOC106567828 coding upstream 1907 28181967 ~ 28184870 (-)
LOC110537339 NA coding upstream 34754 28214814 ~ 28221569 (-)
LOC110537342 LOC106567833 coding upstream 64231 28244291 ~ 28271665 (-)
LOC118937653 NA coding upstream 141580 28321640 ~ 28322881 (-)
LOC110537346 LOC106567838 coding upstream 272832 28452892 ~ 28468708 (-)
G1057446 LOC106567827 non-coding downstream 99 28177304 ~ 28178724 (-)
G1057472 NA non-coding downstream 13981 28164334 ~ 28164842 (-)
G1057380 NA non-coding downstream 146150 28032462 ~ 28032673 (-)
G1056245 NA non-coding downstream 186811 27991693 ~ 27992012 (-)
G1056236 NA non-coding downstream 192920 27985701 ~ 27985903 (-)
G1057437 NA non-coding upstream 8897 28188957 ~ 28191673 (-)
G1057476 NA non-coding upstream 11748 28191808 ~ 28192379 (-)
G1057479 NA non-coding upstream 14202 28194262 ~ 28195682 (-)
G1057435 LOC106567831 non-coding upstream 21269 28201329 ~ 28214296 (-)
G1057449 LOC106567827 other downstream 1750 28176386 ~ 28177073 (-)
G1056225 NA other downstream 200387 27978026 ~ 27978436 (-)
G1055199 NA other downstream 1033330 27145210 ~ 27145493 (-)
G1055010 NA other downstream 1196468 26980783 ~ 26982355 (-)
G1054232 NA other downstream 2519818 25657269 ~ 25659005 (-)
G1057600 NA other upstream 261209 28441269 ~ 28441695 (-)
G1057796 LOC106567846 other upstream 702468 28882528 ~ 28886411 (-)
LOC110537362 LOC106567848 other upstream 715522 28895582 ~ 29021369 (-)
G1057998 NA other upstream 1087384 29267444 ~ 29267991 (-)
LOC110537376 NA other upstream 1213535 29393595 ~ 29436595 (-)

Expression


G1057448 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1057448 Expression in each Bioproject

Bar chart with 20 bars.
G1057448 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network