G1057998



Basic Information


Item Value
gene id G1057998
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 29267444 ~ 29267991 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1205368
GGGGAGATGAATATGGAGATAACAGATCAGCTCAGGAATAACGGGGAGATGAATATGGAGATAACAGATCAGCTCAGGAATAACGGGGAGATGAATATGGAGATAACAGATCAGCTCAGGAATAACAAGGAGATGAATATGGAGATAACAGATCAGCTCAGGAATAACGAGGAGATGAATATGGAGATAACAGATCAGCTCAGGAATAACAAGGAGATGAATATGGAGATAACAGATCAGCTCAGGAATAACGAGGAGATGAATATGGAGATAACAGATCAGCTCAAGAATAGCGGGGAGATGAATATGGCGATAACAGGTCAGCTCAAGAATAACGG

Function


NR:

description
putative uncharacterized protein DDB_G0271606

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1205368 True 338 TUCP 0.42 2 29267444 29267991
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537373 prps1 coding downstream 39784 29211003 ~ 29227660 (-)
LOC110537372 LOC106567857 coding downstream 66467 29194956 ~ 29200977 (-)
LOC110537366 LOC106567852 coding downstream 154500 29089801 ~ 29112952 (-)
cchcr1 cchcr1 coding downstream 211210 29042885 ~ 29056234 (-)
LOC110537362 LOC106567848 coding downstream 246075 28895582 ~ 29021369 (-)
LOC110537376 NA coding upstream 125879 29393595 ~ 29436595 (-)
LOC110536838 sc6a7 coding upstream 171629 29439620 ~ 29440969 (-)
LOC110536839 LOC106567864 coding upstream 197888 29465879 ~ 29473201 (-)
LOC110536842 LOC106568042 coding upstream 339646 29607637 ~ 29608459 (-)
LOC110537384 LOC106567873 coding upstream 411320 29679311 ~ 29682360 (-)
G1057906 NA non-coding downstream 163562 29103651 ~ 29103882 (-)
G1057856 NA non-coding downstream 209421 29057680 ~ 29058023 (-)
G1057885 NA non-coding downstream 229884 29037291 ~ 29037560 (-)
G1058092 NA non-coding upstream 132458 29400449 ~ 29432929 (-)
G1058112 NA non-coding upstream 191607 29459598 ~ 29462775 (-)
G1058114 NA non-coding upstream 195360 29463351 ~ 29463602 (-)
G1057796 LOC106567846 other downstream 381033 28882528 ~ 28886411 (-)
G1057600 NA other downstream 825749 28441269 ~ 28441695 (-)
G1057449 LOC106567827 other downstream 1090371 28176386 ~ 28177073 (-)
G1056225 NA other downstream 1289008 27978026 ~ 27978436 (-)
G1058320 NA other upstream 532862 29800853 ~ 29803616 (-)
LOC110537405 NA other upstream 683564 29951555 ~ 29960420 (-)
G1059183 NA other upstream 1066836 30334827 ~ 30335256 (-)
LOC110537417 rnasek other upstream 1179401 30447386 ~ 30452456 (-)

Expression


G1057998 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1057998 Expression in each Bioproject

Bar chart with 7 bars.
G1057998 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.

Co-expression Network