G1058573



Basic Information


Item Value
gene id G1058573
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 30154925 ~ 30155147 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1206053
tgagaaaccaaggctatcgagtctgccgatgaggatgtggtgattgacagagtcgaaagccttggccagatcaatgaatacggctgcacagtattgtttcttatcgatggcggttaagatatcgtttaggaccttgagggtggctgaggtgcacccatgaccagctctgaaaccagattgcatagcggagaaggtacggtgggattcgaaatggtcggggaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1206053 True 223 lncRNA 0.50 1 30154925 30155147
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537397 LOC106567884 coding downstream 185969 29966318 ~ 29968956 (-)
LOC110537405 NA coding downstream 194505 29951555 ~ 29960420 (-)
LOC110537401 LOC106567879 coding downstream 302781 29842845 ~ 29852144 (-)
LOC110537390 NA coding downstream 397930 29745513 ~ 29757033 (-)
LOC110537384 LOC106567873 coding downstream 472565 29679311 ~ 29682360 (-)
LOC110537402 LOC106567887 coding upstream 82200 30237347 ~ 30257703 (-)
LOC110537396 LOC106567888 coding upstream 115169 30270316 ~ 30304242 (-)
LOC110537406 LOC106567890 coding upstream 152728 30307875 ~ 30323144 (-)
LOC110537410 LOC108431284 coding upstream 192204 30347351 ~ 30369324 (-)
LOC110537411 LOC106567893 coding upstream 215020 30370167 ~ 30380619 (-)
G1058564 NA non-coding downstream 6663 30145578 ~ 30148262 (-)
G1058522 NA non-coding downstream 42200 30112507 ~ 30112725 (-)
G1058451 NA non-coding downstream 103888 30050734 ~ 30051037 (-)
G1058446 NA non-coding downstream 106437 30048108 ~ 30048488 (-)
G1058395 NA non-coding downstream 190576 29963926 ~ 29964349 (-)
G1058585 NA non-coding upstream 12563 30167710 ~ 30167972 (-)
G1058587 NA non-coding upstream 14604 30169751 ~ 30169963 (-)
G1058602 NA non-coding upstream 23209 30178356 ~ 30178575 (-)
G1059162 NA non-coding upstream 87042 30242189 ~ 30243025 (-)
G1058320 NA other downstream 351309 29800853 ~ 29803616 (-)
LOC110537376 NA other downstream 732610 29393595 ~ 29436595 (-)
G1057998 NA other downstream 886934 29267444 ~ 29267991 (-)
LOC110537362 LOC106567848 other downstream 1247906 28895582 ~ 29021369 (-)
G1059183 NA other upstream 179680 30334827 ~ 30335256 (-)
LOC110537417 rnasek other upstream 292245 30447386 ~ 30452456 (-)
LOC110537425 LOC106567906 other upstream 479911 30633836 ~ 30638038 (-)
LOC110537432 NA other upstream 582929 30738076 ~ 30773877 (-)
G1059610 NA other upstream 912438 31067585 ~ 31070860 (-)

Expression


G1058573 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1058573 Expression in each Bioproject

Bar chart with 18 bars.
G1058573 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network