G1059194



Basic Information


Item Value
gene id G1059194
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 30359830 ~ 30360077 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1206727
GTTATGCCCAGAACTGTTTTTACCACCAGAATGTAACTCGTTTGATGAAATTCTTGCCTCTGTTCTGCATGATGTTGAATATTTAGCAGCAGCAGATGAAGGAAAGTCTTGTACTAAAATTAGAAGCGCTCTCCTCTCACCATGGCATCAAAACAATGTTGCTGTATCTCATTTTGAAGCCTGCTATTGCAGCCAAGGAAAGAGTGTGACTGAAGGAAAAACAATTGGATGAGAAGAACAGGTAATGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1206727 True 248 lncRNA 0.40 1 30359830 30360077
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537406 LOC106567890 coding downstream 36686 30307875 ~ 30323144 (-)
LOC110537396 LOC106567888 coding downstream 55588 30270316 ~ 30304242 (-)
LOC110537402 LOC106567887 coding downstream 102127 30237347 ~ 30257703 (-)
LOC110537397 LOC106567884 coding downstream 390874 29966318 ~ 29968956 (-)
LOC110537405 NA coding downstream 399410 29951555 ~ 29960420 (-)
LOC110537411 LOC106567893 coding upstream 10090 30370167 ~ 30380619 (-)
si:ch1073-143l10.2 LOC106567895 coding upstream 57965 30418042 ~ 30422902 (-)
LOC110537417 rnasek coding upstream 87309 30447386 ~ 30452456 (-)
LOC110537415 LOC106567896 coding upstream 96458 30456535 ~ 30460284 (-)
LOC110537418 LOC106567899 coding upstream 102072 30462149 ~ 30465256 (-)
G1059190 NA non-coding downstream 3590 30355946 ~ 30356240 (-)
G1059188 NA non-coding downstream 4030 30355498 ~ 30355800 (-)
G1059185 NA non-coding downstream 9941 30349643 ~ 30349889 (-)
G1059154 NA non-coding downstream 14371 30340029 ~ 30345459 (-)
G1059160 NA non-coding downstream 26948 30330970 ~ 30332882 (-)
G1059202 NA non-coding upstream 9456 30369533 ~ 30369732 (-)
G1059215 NA non-coding upstream 30543 30390620 ~ 30390906 (-)
G1059220 NA non-coding upstream 41921 30401998 ~ 30402224 (-)
G1059226 NA non-coding upstream 64604 30424681 ~ 30425255 (-)
G1059232 NA non-coding upstream 72019 30432096 ~ 30432310 (-)
G1059183 NA other downstream 24574 30334827 ~ 30335256 (-)
G1058320 NA other downstream 556214 29800853 ~ 29803616 (-)
LOC110537376 NA other downstream 937515 29393595 ~ 29436595 (-)
G1057998 NA other downstream 1091839 29267444 ~ 29267991 (-)
LOC110537425 LOC106567906 other upstream 274981 30633836 ~ 30638038 (-)
LOC110537432 NA other upstream 377999 30738076 ~ 30773877 (-)
G1059610 NA other upstream 707508 31067585 ~ 31070860 (-)
G1061331 NA other upstream 1631133 31991210 ~ 31992555 (-)

Expression


G1059194 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1059194 Expression in each Bioproject

Bar chart with 14 bars.
G1059194 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network