G1062537


Basic Information

Item Value
gene id G1062537
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 33508319 ~ 33508863 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1210369
gttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcaattgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttttaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaa

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1210369 True 545 TUCP 0.43 1 33508319 33508863

Neighbor

gene id symbol gene type direction distance location
cxadr LOC106567957 coding upstream 893329 32555056 ~ 32614990 (+)
btg3 btg3 coding upstream 953663 32546918 ~ 32554656 (+)
LOC110537469 LOC106567749 coding upstream 973633 32504245 ~ 32534686 (+)
LOC110537467 LOC106567956 coding upstream 1036948 32458471 ~ 32471371 (+)
prdm15 LOC106567952 coding upstream 1053506 32438318 ~ 32454813 (+)
rnft1 LOC106567963 coding downstream 90076 33598939 ~ 33624023 (+)
ptrh2 ptrh2 coding downstream 273951 33782814 ~ 33784617 (+)
LOC110537484 LOC106567971 coding downstream 364152 33873015 ~ 33880271 (+)
abr LOC106567975 coding downstream 625645 34134508 ~ 34360009 (+)
LOC110537489 LOC106567978 coding downstream 905525 34414388 ~ 34547258 (+)
LOC110537474 NA non-coding upstream 5203 33501934 ~ 33513654 (+)
G1062525 NA non-coding upstream 14009 33494023 ~ 33494310 (+)
G1062524 NA non-coding upstream 15341 33492632 ~ 33492978 (+)
G1062521 NA non-coding upstream 20232 33487831 ~ 33488087 (+)
G1062520 NA non-coding upstream 20513 33487478 ~ 33487806 (+)
G1062538 NA non-coding downstream 1002 33509865 ~ 33510093 (+)
G1062615 NA non-coding downstream 25681 33534544 ~ 33534806 (+)
G1062633 LOC107662719 non-coding downstream 52387 33561250 ~ 33561701 (+)
G1062636 NA non-coding downstream 59316 33568179 ~ 33568403 (+)
G1062647 NA non-coding downstream 64687 33573550 ~ 33657966 (+)
G1062404 NA other upstream 142070 33359734 ~ 33366249 (+)
G1060470 NA other upstream 1696972 31811062 ~ 31811347 (+)
G1059685 LOC106567926 other upstream 2298962 31207629 ~ 31209357 (+)
G1059091 NA other upstream 2501253 31000227 ~ 31007066 (+)
LOC110537434 NA other upstream 2629208 30848508 ~ 30879117 (+)
G1062648 NA other downstream 149415 33658278 ~ 33661949 (+)
ubb ubb other downstream 1258161 34766968 ~ 34770882 (+)
LOC110537506 LOC106567992 other downstream 1467429 34964222 ~ 34982028 (+)
LOC110524522 LOC106605670 other downstream 1961637 35468060 ~ 35471779 (+)
G1064849 NA other downstream 1978875 35487738 ~ 35488944 (+)

Expression

G1062537 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1062537 Expression in each Bioproject

Bar chart with 21 bars.
G1062537 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network