G1063064



Basic Information


Item Value
gene id G1063064
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 34072603 ~ 34095927 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1210927
ttcaaagacttgtcccgaagccactcctgcgttgtcttggctgtgtgcttagggtcgttgtcctgttggaaggtgaaccttcgcccccagtctgaggtcctgagcgctctggagcaggttttcatcaaggatctgtactttgctccattcacctttcccttgatcctgactagtctcccattccctgccgctgaacacatccccacagcatgatgctgccaccaccatgcttcac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1210927 True 235 lncRNA 0.54 2 34072603 34095927
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537484 LOC106567971 coding upstream 195202 33873015 ~ 33880271 (+)
ptrh2 ptrh2 coding upstream 287986 33782814 ~ 33784617 (+)
rnft1 LOC106567963 coding upstream 448580 33598939 ~ 33624023 (+)
LOC110537474 NA coding upstream 558949 33501934 ~ 33513654 (+)
cxadr LOC106567957 coding upstream 1457613 32555056 ~ 32614990 (+)
abr LOC106567975 coding downstream 38581 34134508 ~ 34360009 (+)
LOC110537489 LOC106567978 coding downstream 318461 34414388 ~ 34547258 (+)
LOC118937666 NA coding downstream 390147 34486074 ~ 34490407 (+)
LOC110537491 adora2b coding downstream 457658 34553585 ~ 34566592 (+)
pigl pigl coding downstream 629883 34725810 ~ 34753441 (+)
G1063007 NA non-coding upstream 75927 33992745 ~ 33996676 (+)
G1062938 NA non-coding upstream 199921 33872415 ~ 33872682 (+)
G1062771 NA non-coding upstream 252368 33819513 ~ 33820235 (+)
G1062781 NA non-coding upstream 259884 33775172 ~ 33812719 (+)
G1063107 NA non-coding downstream 451433 34547360 ~ 34547843 (+)
G1063337 NA non-coding downstream 460762 34556689 ~ 34557152 (+)
G1063342 NA non-coding downstream 465336 34561263 ~ 34561501 (+)
G1062648 NA other upstream 410654 33658278 ~ 33661949 (+)
G1062537 NA other upstream 563740 33508319 ~ 33508863 (+)
G1062404 NA other upstream 706354 33359734 ~ 33366249 (+)
G1060470 NA other upstream 2261256 31811062 ~ 31811347 (+)
G1059685 LOC106567926 other upstream 2863246 31207629 ~ 31209357 (+)
ubb ubb other downstream 671097 34766968 ~ 34770882 (+)
LOC110537506 LOC106567992 other downstream 880365 34964222 ~ 34982028 (+)
LOC110524522 LOC106605670 other downstream 1374573 35468060 ~ 35471779 (+)
G1064849 NA other downstream 1391811 35487738 ~ 35488944 (+)
G1065619 NA other downstream 2296707 36392634 ~ 36393022 (+)

Expression


G1063064 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1063064 Expression in each Bioproject

Bar chart with 21 bars.
G1063064 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network