G1069285


Basic Information

Item Value
gene id G1069285
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 38856053 ~ 38910288 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1217801
acattattcatctcatatgcatacgtatatactgtactctatatcatcgacggtatccttatgtaatacatgtatcactagccactttatactatactatgccactttgtttacatactcatctcatttgtacatactgtacccgataccatctactgtatcttgcctatgctgctctgtaccatcactcattcatatatccttatgtacatattctttttccccttacactgtgtacaagacagtagttttggaattgttagttagattacttgttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatgtgacaaataaaatttgatttgatttgatttgatttgattttttgtacctgtttcctccagcatcttcacaaggtcctttgctgttgttctgggattggtttgaacttttcgcaccaaagtacgtggtacct

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1217801 True 482 lncRNA 0.36 2 38856053 38910288

Neighbor

gene id symbol gene type direction distance location
ripply3 ripply3 coding downstream 88497 38766085 ~ 38776459 (-)
ttc3 LOC106567687 coding downstream 103162 38718529 ~ 38752891 (-)
LOC110537568 dyrk1a coding downstream 178180 38634546 ~ 38677873 (-)
LOC110537566 LOC106567683 coding downstream 421966 38431429 ~ 38434087 (-)
LOC110537564 LOC106567681 coding downstream 541431 38305193 ~ 38314622 (-)
LOC110537575 LOC106567692 coding upstream 82508 38992796 ~ 38996885 (-)
LOC110537578 LOC106567694 coding upstream 87094 38997382 ~ 39006119 (-)
LOC110537576 LOC106567693 coding upstream 105239 39014593 ~ 39027908 (-)
LOC110537579 LOC106603438 coding upstream 130984 39041272 ~ 39072520 (-)
LOC110537580 LOC106567695 coding upstream 162960 39073248 ~ 39077590 (-)
G1068238 NA non-coding downstream 526514 38329320 ~ 38329539 (-)
G1068235 NA non-coding downstream 528101 38327734 ~ 38327952 (-)
G1068206 NA non-coding downstream 563139 38292690 ~ 38292914 (-)
G1068203 NA non-coding downstream 565730 38290111 ~ 38290323 (-)
G1069455 LOC106567699 non-coding upstream 196776 39107064 ~ 39108139 (-)
G1069457 NA non-coding upstream 199370 39109658 ~ 39151990 (-)
G1069462 NA non-coding upstream 203544 39113832 ~ 39114452 (-)
G1069480 NA non-coding upstream 213942 39124230 ~ 39185219 (-)
LOC110539142 NA other downstream 1149682 37672182 ~ 37706371 (-)
LOC110537546 ppm1e other downstream 1188799 37603158 ~ 37667366 (-)
LOC110537540 LOC106567738 other downstream 1348909 37505206 ~ 37507238 (-)
LOC110537534 LOC106568022 other downstream 1825369 37019987 ~ 37039930 (-)
G1067426 NA other downstream 1918074 36937319 ~ 36937979 (-)
G1069456 LOC106567699 other upstream 198012 39108300 ~ 39108962 (-)
fkbp6 LOC106567715 other upstream 425816 39336054 ~ 39343006 (-)
G1071725 NA other upstream 2128578 41038866 ~ 41039931 (-)
G1073009 NA other upstream 3135575 42045863 ~ 42062632 (-)

Expression

G1069285 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1069285 Expression in each Bioproject

Bar chart with 19 bars.
G1069285 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network