G1070442



Basic Information


Item Value
gene id G1070442
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 40264571 ~ 40264945 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1219077
ccttaagttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagtatttgtgaacagtagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacgtggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcc

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1219077 True 375 lncRNA 0.42 1 40264571 40264945
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937980 NA coding upstream 89030 40175351 ~ 40175541 (+)
htr3a LOC106567725 coding upstream 700801 39556689 ~ 39563770 (+)
htr3b LOC106567726 coding upstream 709000 39546047 ~ 39555571 (+)
LOC110537603 LOC106567719 coding upstream 862851 39380904 ~ 39401720 (+)
LOC110538893 rfc2 coding upstream 893213 39362997 ~ 39371358 (+)
cadm1a LOC106567730 coding downstream 246213 40511158 ~ 40938098 (+)
LOC110539145 NA coding downstream 764395 41029340 ~ 41030449 (+)
anapc13 anc13 coding downstream 861462 41126407 ~ 41130505 (+)
LOC110537617 LOC106567734 coding downstream 1414598 41679543 ~ 41732016 (+)
LOC110537618 LOC105024202 coding downstream 1485000 41749945 ~ 41762641 (+)
G1070438 NA non-coding upstream 1057 40263297 ~ 40263514 (+)
G1070367 NA non-coding upstream 2327 40261984 ~ 40262244 (+)
G1070165 NA non-coding upstream 209390 40054914 ~ 40055181 (+)
G1070164 NA non-coding upstream 212179 40052170 ~ 40052392 (+)
G1069735 LOC106567728 non-coding upstream 489859 39755566 ~ 39774712 (+)
G1070467 NA non-coding downstream 19312 40284257 ~ 40284460 (+)
G1070471 NA non-coding downstream 22137 40287082 ~ 40287415 (+)
G1070678 NA non-coding downstream 168302 40433247 ~ 40433455 (+)
G1070791 NA non-coding downstream 305772 40570717 ~ 40592202 (+)
styxl1 styxl1 other upstream 1174628 39077007 ~ 39090045 (+)
prkrip1 LOC106567678 other upstream 2023198 38231737 ~ 38241376 (+)
G1067321 LOC106567676 other upstream 2095623 38168337 ~ 38168948 (+)
G1067221 NA other upstream 2325295 37938832 ~ 37939276 (+)
G1067156 LOC100380745 other upstream 2399096 37854888 ~ 37865475 (+)
G1070479 NA other downstream 27507 40292452 ~ 40292734 (+)
G1071144 NA other downstream 849633 41114578 ~ 41114957 (+)
G1071159 NA other downstream 872491 41137436 ~ 41137868 (+)
G1072789 NA other downstream 1932105 42197050 ~ 42216163 (+)
G1074265 NA other downstream 3580222 43845167 ~ 43845968 (+)

Expression


G1070442 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1070442 Expression in each Bioproject

Bar chart with 20 bars.
G1070442 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network