G1075804



Basic Information


Item Value
gene id G1075804
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 44311395 ~ 44311923 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1224709
agtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttgacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttagcatcattagtcatttaggtcaacattggatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatgtcgttccacttcatgattgtgtcccacttgttgttgattcttcacaaaaaaatacagttttatat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1224709 True 529 lncRNA 0.40 1 44311395 44311923
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537653 LOC106567625 coding downstream 16384 44245607 ~ 44295011 (-)
LOC118937676 NA coding downstream 103167 44202181 ~ 44208228 (-)
LOC110537650 LOC106567629 coding downstream 141867 44160926 ~ 44169528 (-)
LOC110537649 LOC106567630 coding downstream 175589 44126926 ~ 44135806 (-)
LOC110537647 LOC106567631 coding downstream 201479 44106634 ~ 44109916 (-)
LOC110537654 LOC106567624 coding upstream 20953 44332876 ~ 44373197 (-)
LOC110537655 LOC106567623 coding upstream 66020 44377943 ~ 44388854 (-)
LOC110538901 LOC106603699 coding upstream 79109 44391032 ~ 44397968 (-)
LOC110537656 capns1 coding upstream 118147 44430070 ~ 44439278 (-)
alkbh6 alkbh6 coding upstream 145053 44456976 ~ 44473459 (-)
G1075790 NA non-coding downstream 7245 44303877 ~ 44304150 (-)
G1075711 NA non-coding downstream 120517 44190677 ~ 44190878 (-)
G1075693 NA non-coding downstream 153929 44157173 ~ 44157466 (-)
G1075429 NA non-coding downstream 166447 44137965 ~ 44144948 (-)
G1075664 NA non-coding downstream 247442 44063514 ~ 44063953 (-)
G1075825 NA non-coding upstream 14667 44326590 ~ 44326906 (-)
G1075939 NA non-coding upstream 97850 44409773 ~ 44410004 (-)
G1075944 NA non-coding upstream 104455 44416378 ~ 44416827 (-)
G1075945 NA non-coding upstream 105503 44417426 ~ 44417628 (-)
G1075950 NA non-coding upstream 114174 44426097 ~ 44426312 (-)
G1075509 NA other downstream 536970 43774064 ~ 43774425 (-)
G1075399 NA other downstream 650558 43660559 ~ 43660837 (-)
G1075335 NA other downstream 747155 43563785 ~ 43564240 (-)
G1074731 NA other downstream 1597472 42704003 ~ 42713923 (-)
G1073009 NA other downstream 2248763 42045863 ~ 42062632 (-)
G1076460 NA other upstream 142725 44454648 ~ 44455270 (-)
LOC110537661 LOC101073377 other upstream 234596 44546519 ~ 44601149 (-)
gria4b LOC106567580 other upstream 821929 45133844 ~ 45296904 (-)
G1078323 LOC106567565 other upstream 1890681 46202604 ~ 46206088 (-)
G1078783 NA other upstream 2504520 46816443 ~ 46817065 (-)

Expression


G1075804 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1075804 Expression in each Bioproject

Bar chart with 19 bars.
G1075804 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network