G1078742



Basic Information


Item Value
gene id G1078742
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 46788989 ~ 46789214 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1227920
gtaccatcactcattcatatatctttatgtacatattctttatccccttacacttgtgtgtataagacagtagttttggaattgttagttagattacttgttggttattactgcattgtcggaactagaagcacaagcatttcgctacactcgcattaacatctgctaaccatgtgtatgtgacaaataaaatttgatttgatttaaattggatgcacctgatctc

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1227920 True 226 lncRNA 0.34 1 46788989 46789214

Neighbor


gene id symbol gene type direction distance location
LOC110537698 LOC106567561 coding downstream 99408 46382502 ~ 46689581 (-)
LOC118937925 NA coding downstream 426530 46362328 ~ 46362459 (-)
LOC110537697 gatsl2 coding downstream 445523 46322347 ~ 46343466 (-)
foxr1 LOC106567616 coding downstream 545011 46241530 ~ 46243978 (-)
LOC110537691 LOC106567568 coding downstream 765313 46017383 ~ 46023676 (-)
LOC110537699 LOC106567556 coding upstream 122243 46911457 ~ 47297035 (-)
LOC110537700 LOC106567555 coding upstream 837442 47626656 ~ 47658365 (-)
LOC110537701 LOC106567554 coding upstream 873830 47663044 ~ 47711376 (-)
LOC110537702 LOC106567552 coding upstream 923796 47712366 ~ 47791030 (-)
LOC110537706 LOC106567549 coding upstream 1122434 47911648 ~ 47942039 (-)
G1078736 NA non-coding downstream 2472 46786288 ~ 46786517 (-)
G1078728 NA non-coding downstream 9393 46779349 ~ 46779596 (-)
G1078721 NA non-coding downstream 17489 46771229 ~ 46771500 (-)
G1078661 NA non-coding downstream 58406 46695767 ~ 46730583 (-)
G1078630 NA non-coding downstream 139700 46649076 ~ 46649289 (-)
G1078758 NA non-coding upstream 8203 46797417 ~ 46798153 (-)
G1078762 NA non-coding upstream 12722 46801936 ~ 46802202 (-)
G1078796 NA non-coding upstream 36251 46825465 ~ 46825678 (-)
G1079157 NA non-coding upstream 80435 46869649 ~ 46869863 (-)
G1079161 NA non-coding upstream 84765 46873979 ~ 46874336 (-)
G1078323 LOC106567565 other downstream 582901 46202604 ~ 46206088 (-)
gria4b LOC106567580 other downstream 1635652 45133844 ~ 45296904 (-)
LOC110537661 LOC101073377 other downstream 2188101 44546519 ~ 44601149 (-)
G1076460 NA other downstream 2333719 44454648 ~ 44455270 (-)
G1075509 NA other downstream 3014564 43774064 ~ 43774425 (-)
G1078783 NA other upstream 27229 46816443 ~ 46817065 (-)
G1081055 NA other upstream 1629207 48418421 ~ 48418884 (-)
G1081571 NA other upstream 2112194 48901408 ~ 48905274 (-)
G1081813 NA other upstream 2198798 48988012 ~ 48988353 (-)

Expression



Co-expression Network