G1085968



Basic Information


Item Value
gene id G1085968
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 52416826 ~ 52417675 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1235562
tccgcctgcgctagaaaggttaacctctagcacttagccatcccggatccgggatcgtgaatacagcctcaagctcattaccataacgcaacgttaactattcatgaaaatcgcaaatgaaatgaaataaatatgctagctctcaagcttagccttttgtaaacaacactgtcatctcagattttcaaaatatgcttctcaaccataggaaaacaatcatttgtgtaacagtagctagctagcgtagcatttagcgttagcgttagcattcagcaggcaacattttcacaaaaaacagaaaagcattcaaataaaataatttacttttgaagaacttcagatgttttcaatgaggagactctgttagatagcaaatgttcagtttttcctgaaagattatttgtttaggagaaatcgctccgtttggtgcgtcacgtttggctaccaaaaaaaaacgaaaatccagtcatcaaaacgccaaacttttttccaaattaactccataatatcgactgaaacatggcaaacgttgtttagaaccaatcctcaaggtgtttttcacatatctcttcgatgatatatctttcgtggaagtgtgctttctctcctgaatcccaggagaaaatgcccgcacctgaagattacgcaccaatttagacaaaggacaccgggcggacccctggaaaatgtagtctcttatggccaatcttccaatgatatgcctacaaatacgtcacaatgctgcagacatcttgaagaaacgacagaaagggcaggctcgttcgtggtgcattcacagccatataaggagacaatggaaaacagagcttcagaaattctgctaatttcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1235562 True 850 lncRNA 0.40 1 52416826 52417675

Neighbor


gene id symbol gene type direction distance location
LOC110537755 LOC106567504 coding upstream 184598 52164071 ~ 52232228 (+)
LOC110537753 LOC106567505 coding upstream 292426 52087532 ~ 52124400 (+)
LOC110537754 LOC106603847 coding upstream 351654 52026941 ~ 52065243 (+)
LOC110537746 LOC106567511 coding upstream 828935 51547730 ~ 51587891 (+)
LOC110537744 LOC106567513 coding upstream 966018 51414096 ~ 51450808 (+)
LOC110537762 LOC106567497 coding downstream 386552 52804227 ~ 52821797 (+)
LOC110537763 rnf14 coding downstream 419003 52836678 ~ 52842725 (+)
endou2 LOC106567496 coding downstream 425444 52843119 ~ 52851325 (+)
LOC110537765 LOC106567495 coding downstream 433976 52851651 ~ 52861272 (+)
LOC110537768 LOC106567493 coding downstream 587154 53004829 ~ 53132925 (+)
G1085943 NA non-coding upstream 16115 52400315 ~ 52400711 (+)
G1085931 NA non-coding upstream 23214 52393393 ~ 52393612 (+)
G1085820 NA non-coding upstream 93172 52323442 ~ 52323654 (+)
G1085809 NA non-coding upstream 103902 52312662 ~ 52312924 (+)
G1085806 NA non-coding upstream 105038 52311554 ~ 52311788 (+)
G1086090 NA non-coding downstream 77463 52495138 ~ 52495501 (+)
G1086110 NA non-coding downstream 92784 52510459 ~ 52510680 (+)
G1086112 NA non-coding downstream 95192 52512867 ~ 52513067 (+)
G1086113 NA non-coding downstream 95741 52513416 ~ 52514041 (+)
G1086147 NA non-coding downstream 118704 52536379 ~ 52536610 (+)
G1082266 NA other upstream 2736022 49679023 ~ 49680804 (+)
LOC110537713 LOC106567542 other upstream 3116479 49262142 ~ 49300347 (+)
G1081353 NA other upstream 3669327 48746955 ~ 48747499 (+)
G1077322 NA other upstream 6408217 46004151 ~ 46008609 (+)
nrgna NA other upstream 6496565 45900621 ~ 45920265 (+)
G1086237 LOC106567502 other downstream 231929 52649604 ~ 52657495 (+)
G1087914 NA other downstream 1692015 54109690 ~ 54148962 (+)
LOC110538908 LOC106603872 other downstream 1856631 54253719 ~ 54283905 (+)
G1091217 NA other downstream 4307932 56725607 ~ 56726003 (+)
G1091235 NA other downstream 4334743 56752418 ~ 56752947 (+)

Expression


G1085968 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1085968 Expression in each Bioproject

Bar chart with 20 bars.
G1085968 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network