G1086161



Basic Information


Item Value
gene id G1086161
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 52544128 ~ 52544369 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1235760
tgtttctggtgtcctttgacagctctttggtcttggccatagtggagtatggagtgtgactgtttgaggttgtggacagaagtcttttatactgataacaagttcaaacaggtgccattaatacaggtaacgagtggaggacagaggagcctcttaaagaaggtctgtgagagccataaatcttgcttgtttgtaggtgaccaaatacttattttccaccataatttgcaaataaattcatt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1235760 True 242 lncRNA 0.40 1 52544128 52544369
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537755 LOC106567504 coding upstream 311900 52164071 ~ 52232228 (+)
LOC110537753 LOC106567505 coding upstream 419728 52087532 ~ 52124400 (+)
LOC110537754 LOC106603847 coding upstream 478956 52026941 ~ 52065243 (+)
LOC110537746 LOC106567511 coding upstream 956237 51547730 ~ 51587891 (+)
LOC110537744 LOC106567513 coding upstream 1093320 51414096 ~ 51450808 (+)
LOC110537762 LOC106567497 coding downstream 259858 52804227 ~ 52821797 (+)
LOC110537763 rnf14 coding downstream 292309 52836678 ~ 52842725 (+)
endou2 LOC106567496 coding downstream 298750 52843119 ~ 52851325 (+)
LOC110537765 LOC106567495 coding downstream 307282 52851651 ~ 52861272 (+)
LOC110537768 LOC106567493 coding downstream 460460 53004829 ~ 53132925 (+)
G1086152 NA non-coding upstream 6098 52537802 ~ 52538030 (+)
G1086147 NA non-coding upstream 7518 52536379 ~ 52536610 (+)
G1086113 NA non-coding upstream 30087 52513416 ~ 52514041 (+)
G1086112 NA non-coding upstream 31061 52512867 ~ 52513067 (+)
G1086110 NA non-coding upstream 33448 52510459 ~ 52510680 (+)
G1086381 NA non-coding downstream 303657 52848026 ~ 52848279 (+)
G1086390 NA non-coding downstream 325693 52870062 ~ 52870307 (+)
G1086400 NA non-coding downstream 335174 52879543 ~ 52879750 (+)
G1086404 NA non-coding downstream 340826 52885195 ~ 52885522 (+)
G1086409 NA non-coding downstream 350200 52894569 ~ 52894887 (+)
G1082266 NA other upstream 2863324 49679023 ~ 49680804 (+)
LOC110537713 LOC106567542 other upstream 3243781 49262142 ~ 49300347 (+)
G1081353 NA other upstream 3796629 48746955 ~ 48747499 (+)
G1077322 NA other upstream 6535519 46004151 ~ 46008609 (+)
nrgna NA other upstream 6623867 45900621 ~ 45920265 (+)
G1086237 LOC106567502 other downstream 105235 52649604 ~ 52657495 (+)
G1087914 NA other downstream 1565321 54109690 ~ 54148962 (+)
LOC110538908 LOC106603872 other downstream 1729937 54253719 ~ 54283905 (+)
G1091217 NA other downstream 4181238 56725607 ~ 56726003 (+)
G1091235 NA other downstream 4208049 56752418 ~ 56752947 (+)

Expression


G1086161 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1086161 Expression in each Bioproject

Bar chart with 18 bars.
G1086161 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network