G1091183



Basic Information


Item Value
gene id G1091183
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 56658183 ~ 56658481 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1241102
aatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacgtaccccaagcgacttacagctgtaatcgcagcaaaaggtggcactacaaagtattaacttaagggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaatagatgtagttccacttcatgattgtgtcccacttgttg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1241102 True 299 lncRNA 0.40 1 56658183 56658481

Neighbor


gene id symbol gene type direction distance location
LOC110537820 LOC106567415 coding downstream 77069 56575548 ~ 56581114 (-)
LOC118937888 NA coding downstream 134813 56513261 ~ 56523370 (-)
LOC110537819 LOC106567417 coding downstream 280076 56283753 ~ 56378107 (-)
LOC118937819 LOC106567418 coding downstream 500205 56096417 ~ 56157978 (-)
LOC118937818 LOC106567418 coding downstream 592959 56046013 ~ 56065224 (-)
LOC110537825 NA coding upstream 2110 56660591 ~ 56662844 (-)
LOC118937889 NA coding upstream 116096 56774577 ~ 56777945 (-)
LOC110537827 p2rx1 coding upstream 378390 57036871 ~ 57089516 (-)
LOC118937684 NA coding upstream 600298 57258779 ~ 57274990 (-)
LOC100136198 LOC100136198 coding upstream 707902 57366383 ~ 57379112 (-)
G1091134 NA non-coding downstream 87607 56570166 ~ 56570576 (-)
G1091119 NA non-coding downstream 118478 56529736 ~ 56539705 (-)
G1091116 NA non-coding downstream 132319 56525651 ~ 56525864 (-)
G1091028 NA non-coding downstream 154371 56503560 ~ 56503812 (-)
G1091013 NA non-coding downstream 162630 56495343 ~ 56495553 (-)
G1092168 NA non-coding upstream 55068 56713549 ~ 56719245 (-)
G1092175 NA non-coding upstream 67285 56725766 ~ 56726881 (-)
G1092192 NA non-coding upstream 93898 56752379 ~ 56752882 (-)
G1092204 NA non-coding upstream 207109 56865590 ~ 56869084 (-)
G1090502 NA other downstream 595476 56062430 ~ 56062707 (-)
G1087093 NA other downstream 3525308 53131805 ~ 53132875 (-)
LOC110537745 LOC106567512 other downstream 5141104 51453362 ~ 51520396 (-)
G1084908 NA other downstream 5181412 51476417 ~ 51476771 (-)
G1092205 LOC106567410 other upstream 198857 56857338 ~ 56859147 (-)
G1092523 NA other upstream 697683 57291444 ~ 57357274 (-)
pitpnbl LOC107739385 other upstream 2520005 59144152 ~ 59187749 (-)
G1094699 NA other upstream 2850117 59508598 ~ 59539380 (-)
G1094783 NA other upstream 3041987 59700468 ~ 59702147 (-)

Expression


G1091183 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1091183 Expression in each Bioproject

Bar chart with 19 bars.
G1091183 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network