G1091235



Basic Information


Item Value
gene id G1091235
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 56752418 ~ 56752947 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1241171
atgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacacgccacctgggagacacaccagacatgtggaagaaggtgttctggccagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctcatcaccctgaacacaccatgcccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagtcaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatcaacaatggaatggttcaaaaataaa

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1241171 True 530 TUCP 0.43 1 56752418 56752947
Loading

Neighbor


gene id symbol gene type direction distance location
zzef1 zzef1 coding upstream 38136 56663069 ~ 56719231 (+)
LOC110538909 ankfy1 coding upstream 94867 56615568 ~ 56657551 (+)
ube2g1a ube2g1 coding upstream 148042 56594310 ~ 56604376 (+)
LOC110537822 NA coding upstream 177823 56572425 ~ 56574595 (+)
LOC100136702 LOC100136702 coding upstream 497257 56253926 ~ 56255161 (+)
LOC110537826 LOC106567410 coding downstream 39669 56792616 ~ 56869110 (+)
camkk1a LOC106567408 coding downstream 160076 56913023 ~ 57033702 (+)
LOC110537831 dhx33 coding downstream 359955 57112902 ~ 57118165 (+)
LOC110537832 LOC106567406 coding downstream 373800 57126747 ~ 57131602 (+)
LOC110537833 LOC106567405 coding downstream 393568 57146515 ~ 57185366 (+)
G1091231 NA non-coding upstream 5922 56746260 ~ 56746496 (+)
G1091224 NA non-coding upstream 17430 56734734 ~ 56734988 (+)
G1091106 NA non-coding upstream 93664 56658234 ~ 56658754 (+)
G1091237 NA non-coding downstream 2821 56755768 ~ 56756068 (+)
G1091212 NA non-coding downstream 36375 56789322 ~ 56827110 (+)
G1091330 NA non-coding downstream 282801 57035748 ~ 57039445 (+)
G1091440 NA non-coding downstream 337103 57090050 ~ 57090274 (+)
G1091443 NA non-coding downstream 341617 57094564 ~ 57094782 (+)
G1091217 NA other upstream 26415 56725607 ~ 56726003 (+)
LOC110538908 LOC106603872 other upstream 2471697 54253719 ~ 54283905 (+)
G1087914 NA other upstream 2603456 54109690 ~ 54148962 (+)
G1086237 LOC106567502 other upstream 4094923 52649604 ~ 52657495 (+)
G1082266 NA other upstream 7071614 49679023 ~ 49680804 (+)
LOC110537841 mtmr4 other downstream 1146524 57893341 ~ 58071571 (+)
LOC118937686 NA other downstream 1463208 58216142 ~ 58222215 (+)
G1093909 NA other downstream 2788611 59541558 ~ 59542603 (+)
G1094218 LOC100380853 other downstream 3278056 60031003 ~ 60034020 (+)

Expression


G1091235 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1091235 Expression in each Bioproject

Bar chart with 20 bars.
G1091235 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network