G1093233



Basic Information


Item Value
gene id G1093233
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 58384723 ~ 58384927 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1243311
GATGGTAACTAAGCTGTCCAACTACAACCTGAGCACTGAGGACTGAGTGCCGATTACCTTCCTCCTCCCACTGGACGGCACTGGCCTAATTCTCGCTGCCCTACAGGACCCCCCGGCCACAAACGGAAATGGCGTGACCGGGATTTGTACCCCGGTTATAGCGACACAGTTGCACTCTGAGGCAGGTCCCTAGACCATTGAGAGA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1243311 True 205 lncRNA 0.56 1 58384723 58384927
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110537848 sp30l coding upstream 98095 58274018 ~ 58286628 (+)
LOC110537846 ggnbp2 coding upstream 111937 58225787 ~ 58272786 (+)
LOC118937686 NA coding upstream 162508 58216142 ~ 58222215 (+)
LOC110537844 LOC106567395 coding upstream 200274 58159958 ~ 58184449 (+)
ca4a NA coding upstream 283187 58076921 ~ 58101536 (+)
LOC110539153 LOC106604490 coding downstream 143363 58528290 ~ 58530219 (+)
LOC110538918 nkx3-2 coding downstream 160219 58545146 ~ 58546597 (+)
rab28 LOC106600633 coding downstream 190674 58575601 ~ 58625910 (+)
LOC110538919 atp8a1 coding downstream 306190 58691117 ~ 58827450 (+)
LOC110538920 NA coding downstream 465809 58850736 ~ 58873451 (+)
G1093228 NA non-coding upstream 7948 58376559 ~ 58376775 (+)
G1093215 NA non-coding upstream 22050 58362411 ~ 58362673 (+)
G1093214 NA non-coding upstream 22485 58361937 ~ 58362238 (+)
G1093199 NA non-coding upstream 33643 58350875 ~ 58351080 (+)
G1093198 NA non-coding upstream 33849 58350639 ~ 58350874 (+)
G1093243 NA non-coding downstream 17539 58402466 ~ 58415184 (+)
G1093244 NA non-coding downstream 18369 58403296 ~ 58410859 (+)
G1093248 NA non-coding downstream 30860 58415787 ~ 58421231 (+)
G1093252 NA non-coding downstream 40419 58425346 ~ 58459681 (+)
G1093326 NA non-coding downstream 119869 58504796 ~ 58505068 (+)
LOC110537841 mtmr4 other upstream 469891 57893341 ~ 58071571 (+)
LOC110537831 dhx33 other upstream 1266796 57112902 ~ 57118165 (+)
G1091235 NA other upstream 1631776 56752418 ~ 56752947 (+)
G1091217 NA other upstream 1658720 56725607 ~ 56726003 (+)
G1093909 NA other downstream 1156631 59541558 ~ 59542603 (+)
G1094218 LOC100380853 other downstream 1646076 60031003 ~ 60034020 (+)
G1095244 LOC108238713 other downstream 2000737 60385664 ~ 60385973 (+)
LOC110539079 LOC106600700 other downstream 2311760 60696612 ~ 60777061 (+)
G1095209 NA other downstream 2431564 60816491 ~ 60818897 (+)

Expression


G1093233 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1093233 Expression in each Bioproject

Bar chart with 9 bars.
G1093233 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 70.
End of interactive chart.

Co-expression Network