G1093680



Basic Information


Item Value
gene id G1093680
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 58892952 ~ 58893163 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1243852
gaaatgtacattcaattatctggcaacagctctgcagtcagcattccaatttcactctccttcaaaacttgagacattggtggcattgtgttgtatgacaaaactgcacattttagtggcctagtgtccccagtacaaggtgcacctgtgtaatgagcatgtcgtttaattagcttcttgatattacacacctgtcaggtggatggattatc

Function


NR:

description
myelin protein zero-like protein 2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1243852 True 212 lncRNA 0.42 1 58892952 58893163

Neighbor


gene id symbol gene type direction distance location
LOC110538920 NA coding upstream 19501 58850736 ~ 58873451 (+)
LOC110538919 atp8a1 coding upstream 68381 58691117 ~ 58827450 (+)
rab28 LOC106600633 coding upstream 268495 58575601 ~ 58625910 (+)
LOC110538918 nkx3-2 coding upstream 346355 58545146 ~ 58546597 (+)
LOC110539153 LOC106604490 coding upstream 362733 58528290 ~ 58530219 (+)
LOC110537868 LOC106600641 coding downstream 42367 58935530 ~ 58959234 (+)
LOC110537870 LOC100380866 coding downstream 68604 58961767 ~ 58975136 (+)
LOC110537871 LOC106604470 coding downstream 159166 59052329 ~ 59106006 (+)
sez6l2 sez6l2 coding downstream 340191 59233354 ~ 59343106 (+)
kctd13 LOC106600645 coding downstream 457616 59350779 ~ 59389927 (+)
G1093678 NA non-coding upstream 2056 58890622 ~ 58890896 (+)
G1093544 NA non-coding upstream 218145 58674579 ~ 58674807 (+)
G1093541 NA non-coding upstream 220400 58672342 ~ 58672552 (+)
G1093537 NA non-coding upstream 222237 58670410 ~ 58670715 (+)
G1093713 NA non-coding downstream 88093 58981256 ~ 58981520 (+)
G1093714 NA non-coding downstream 89110 58982273 ~ 58982472 (+)
G1093715 NA non-coding downstream 89472 58982635 ~ 58982914 (+)
G1093719 NA non-coding downstream 93284 58986447 ~ 58987204 (+)
G1093810 NA non-coding downstream 225559 59118722 ~ 59118929 (+)
LOC118937686 NA other upstream 670762 58216142 ~ 58222215 (+)
LOC110537841 mtmr4 other upstream 978120 57893341 ~ 58071571 (+)
LOC110537831 dhx33 other upstream 1775025 57112902 ~ 57118165 (+)
G1091235 NA other upstream 2140005 56752418 ~ 56752947 (+)
G1091217 NA other upstream 2166949 56725607 ~ 56726003 (+)
G1093909 NA other downstream 648395 59541558 ~ 59542603 (+)
G1094218 LOC100380853 other downstream 1137840 60031003 ~ 60034020 (+)
G1095244 LOC108238713 other downstream 1492501 60385664 ~ 60385973 (+)
LOC110539079 LOC106600700 other downstream 1803524 60696612 ~ 60777061 (+)
G1095209 NA other downstream 1923328 60816491 ~ 60818897 (+)

Expression


G1093680 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1093680 Expression in each Bioproject

Bar chart with 8 bars.
G1093680 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network