G1097953 (sh2b1)



Basic Information


Item Value
gene id G1097953
gene name sh2b1
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 61803710 ~ 61808501 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1248702
GTACACATATCTTCAATGGGATGATACACACGCACACTATATTGATTCACTGACGTAACAGCATAGTGTAACCCAATCATAATGCATAAAACACATACACCGGACATACAACACCCAAGACGTGCCTTTAGAGGCCAGTGTAAAACCAGTGTCGTTTCATCCTAGTGGAATATCCTGTGACCTTTCACCCCTGACCGGTTACCTGGCTGCCGGACGGCGGTGGCGCCCACAAAGCTGATGAGAGTGACGTCCGAGGCACCCCCAGACTCCAGGGGGATTGGGTGCACGCGGAAGTGCTCCAGCATGTCGAATATGGACTGGAACCACAGGTGCTGCACCCGGCACTGGCCGTCCTCGTTCAGAGACAAACGCAGGTGCTTGGCCTTGCCTTGGAAGTTGAAGGTGAGGACGTACTCCCCGCGGCGTGTCTCGCTCTGGCGCACAAGGAAGACGCCGTGGCTGGCCGTACCCCCTGCCAGCACAAGCTGGGCCGCCTTCAGGCGCGACAACGTCCCGTGGAACCACTGGCACTCGCTCAGAGGGTGCTCCACCGCCTCCGCCACATCTGAGAACAGGAAGG

Function


symbol description
sh2b1 Predicted to enable transmembrane receptor protein tyrosine kinase adaptor activity. Predicted to be involved in intracellular signal transduction. Predicted to act upstream of or within signal transduction. Predicted to be active in plasma membrane. Orthologous to human SH2B1 (SH2B adaptor protein 1).

NR:

description
PREDICTED: SH2B adapter protein 1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1248702 True 580 TUCP 0.57 2 61803710 61808501
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937697 NA coding downstream 3380 61772775 ~ 61800330 (-)
LOC110537915 LOC106601018 coding downstream 11266 61788631 ~ 61792444 (-)
LOC110538926 LOC106600736 coding downstream 36525 61766529 ~ 61767185 (-)
rabep2 rabep2 coding downstream 39019 61754035 ~ 61764691 (-)
LOC110539092 LOC106600714 coding downstream 147101 61639630 ~ 61656609 (-)
spns1 LOC106600742 coding upstream 25165 61833666 ~ 61866662 (-)
LOC110537920 nfatc2ip coding upstream 58960 61867461 ~ 61873567 (-)
LOC110537921 sgf29 coding upstream 74179 61882680 ~ 61892555 (-)
LOC110537924 LOC106600747 coding upstream 194707 62003208 ~ 62006661 (-)
LOC110537925 LOC106600748 coding upstream 198334 62006835 ~ 62011339 (-)
G1097944 LOC106600735 non-coding downstream 31066 61771035 ~ 61772644 (-)
G1097941 NA non-coding downstream 50082 61753334 ~ 61753628 (-)
G1097938 NA non-coding downstream 50385 61748482 ~ 61753325 (-)
G1097913 NA non-coding downstream 91136 61712355 ~ 61712574 (-)
G1097896 NA non-coding downstream 110532 61692759 ~ 61693178 (-)
G1097999 NA non-coding upstream 67278 61875779 ~ 61875989 (-)
G1098000 NA non-coding upstream 68264 61876765 ~ 61877006 (-)
G1098001 NA non-coding upstream 68577 61877078 ~ 61877963 (-)
G1098003 NA non-coding upstream 70780 61879281 ~ 61879541 (-)
G1098005 NA non-coding upstream 72093 61880594 ~ 61880996 (-)
ypel3 LOC103040367 other downstream 190585 61602944 ~ 61613176 (-)
G1097852 LOC106600701 other downstream 210247 61591238 ~ 61593463 (-)
G1097817 NA other downstream 298876 61503960 ~ 61504834 (-)
G1097645 NA other downstream 478998 61038716 ~ 61324712 (-)
LOC110539101 NA other downstream 559383 61144112 ~ 61244327 (-)
G1098154 LOC106600756 other upstream 374249 62182750 ~ 62185946 (-)
G1098256 LOC106600954 other upstream 680666 62380280 ~ 62490254 (-)
LOC110537983 LOC106600926 other upstream 1644614 63453115 ~ 63467479 (-)
lmx1al LOC106600915 other upstream 1854704 63659040 ~ 63685854 (-)
G1099090 LOC105030512 other upstream 2331961 64140462 ~ 64140912 (-)

Expression


G1097953(sh2b1) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.3.
End of interactive chart.

G1097953(sh2b1) Expression in each Bioproject

Bar chart with 11 bars.
G1097953(sh2b1) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network