G1096422



Basic Information


Item Value
gene id G1096422
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 62948128 ~ 62948364 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1246940
CTAACAACCCTATCAAATACTCTGCTAACTACCCTATCAAATACTCTGCTAACAACACTGTCAAATAAACAGCTAACAACAGGAAAAAGACCAGATGTGGTGCTCTCTCAAATCTGGGAATAACACATGACAGTTAAAGAGGCTGTACAGAATTTCTGACAGAAACAATTAGTAACTTAGCTTCCATTGTGTACTGTGTATTCAAGTTACACGAATACAGACGATCCCACCTTGTAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1246940 True 237 lncRNA 0.38 1 62948128 62948364

Neighbor


gene id symbol gene type direction distance location
syt5a LOC106600948 coding upstream 198548 62733537 ~ 62749580 (+)
LOC110538929 NA coding upstream 215432 62726245 ~ 62732696 (+)
LOC110537946 LOC106600765 coding upstream 235007 62710478 ~ 62713121 (+)
LOC118936485 LOC106600765 coding upstream 264743 62679360 ~ 62683385 (+)
LOC100136293 LOC106600765 coding upstream 291729 62654545 ~ 62656399 (+)
prl LOC100136792 coding downstream 342 62948706 ~ 62952733 (+)
LOC110537969 LOC106600937 coding downstream 202462 63150826 ~ 63165217 (+)
LOC110537970 LOC106600936 coding downstream 224744 63173108 ~ 63181229 (+)
LOC110537972 LOC106600934 coding downstream 335451 63283815 ~ 63287720 (+)
LOC100305204 hebp2 coding downstream 354170 63302491 ~ 63334694 (+)
G1096408 NA non-coding upstream 13119 62934688 ~ 62935009 (+)
G1096407 NA non-coding upstream 15975 62931891 ~ 62932153 (+)
G1096406 NA non-coding upstream 17230 62916666 ~ 62930898 (+)
G1096401 NA non-coding upstream 39912 62905599 ~ 62908216 (+)
G1096393 NA non-coding upstream 52691 62894637 ~ 62895437 (+)
G1096431 NA non-coding downstream 10675 62959039 ~ 62959267 (+)
G1096433 NA non-coding downstream 148165 63096529 ~ 63103349 (+)
G1096539 NA non-coding downstream 187288 63135652 ~ 63135855 (+)
G1096570 LOC106600935 non-coding downstream 242732 63191096 ~ 63192057 (+)
G1096603 NA non-coding downstream 280365 63228729 ~ 63229110 (+)
LOC118937701 LOC100136295 other upstream 500654 62441706 ~ 62448515 (+)
G1095540 NA other upstream 1595783 61037739 ~ 61352345 (+)
mmp25a LOC106600705 other upstream 1982533 60931123 ~ 60965921 (+)
G1095209 NA other upstream 2129231 60816491 ~ 60818897 (+)
LOC110539079 LOC106600700 other upstream 2234116 60696612 ~ 60777061 (+)
LOC110538933 LOC106600901 other downstream 939732 63888086 ~ 63908673 (+)
G1097063 NA other downstream 1187994 64136358 ~ 64136704 (+)
G1097116 NA other downstream 1279637 64228001 ~ 64228684 (+)
G1097122 NA other downstream 1306248 64254612 ~ 64255064 (+)

Expression


G1096422 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1096422 Expression in each Bioproject

Bar chart with 8 bars.
G1096422 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network