G1096603


Basic Information

Item Value
gene id G1096603
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 63228729 ~ 63229110 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1247131
gcctatatatactgtaatatgtgtgtgtgttcactaacaagtctaaaacaagacacctgcttagcctttcagctgaaattgcaatcagcagtgtttgaaaggcacaaggctgaaatctattccgttttgaatgtgtggttcacagttttgacagcagtgtgttagcatttgaacaaagtgctgtaaatccacagtgttgtgcaggttgtggttaaagtcatgggataagtgtgtagagttttgaaaactgtgttcaagcaatgaaaaacgaactagagtttggtccacataaactgctgctgtgcagactgtagttagagttttgcacatgtgactccagttgtgtccactgtcgtttagcaatcgaaaaaaactgtaatga

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1247131 True 382 lncRNA 0.40 1 63228729 63229110

Neighbor

gene id symbol gene type direction distance location
LOC110537970 LOC106600936 coding upstream 47500 63173108 ~ 63181229 (+)
LOC110537969 LOC106600937 coding upstream 63512 63150826 ~ 63165217 (+)
prl LOC100136792 coding upstream 275996 62948706 ~ 62952733 (+)
syt5a LOC106600948 coding upstream 479149 62733537 ~ 62749580 (+)
LOC110538929 NA coding upstream 496033 62726245 ~ 62732696 (+)
LOC110537972 LOC106600934 coding downstream 54705 63283815 ~ 63287720 (+)
LOC100305204 hebp2 coding downstream 73424 63302491 ~ 63334694 (+)
LOC110537973 LOC106600933 coding downstream 100797 63329907 ~ 63333490 (+)
nr5a5 LOC106600931 coding downstream 117447 63346557 ~ 63358913 (+)
LOC110537979 NA coding downstream 196276 63425386 ~ 63426072 (+)
G1096570 LOC106600935 non-coding upstream 36672 63191096 ~ 63192057 (+)
G1096539 NA non-coding upstream 92874 63135652 ~ 63135855 (+)
G1096433 NA non-coding upstream 125380 63096529 ~ 63103349 (+)
G1096431 NA non-coding upstream 269462 62959039 ~ 62959267 (+)
G1096422 NA non-coding upstream 280365 62948128 ~ 62948364 (+)
G1096635 NA non-coding downstream 49967 63279077 ~ 63279363 (+)
G1096640 NA non-coding downstream 59678 63288788 ~ 63289565 (+)
G1096664 NA non-coding downstream 112106 63341216 ~ 63346315 (+)
G1096675 NA non-coding downstream 141132 63370242 ~ 63370501 (+)
G1096676 NA non-coding downstream 141589 63370699 ~ 63370992 (+)
LOC118937701 LOC100136295 other upstream 781255 62441706 ~ 62448515 (+)
G1095540 NA other upstream 1876384 61037739 ~ 61352345 (+)
mmp25a LOC106600705 other upstream 2263134 60931123 ~ 60965921 (+)
G1095209 NA other upstream 2409832 60816491 ~ 60818897 (+)
LOC110539079 LOC106600700 other upstream 2514717 60696612 ~ 60777061 (+)
LOC110538933 LOC106600901 other downstream 658986 63888086 ~ 63908673 (+)
G1097063 NA other downstream 907248 64136358 ~ 64136704 (+)
G1097116 NA other downstream 998891 64228001 ~ 64228684 (+)
G1097122 NA other downstream 1025502 64254612 ~ 64255064 (+)

Expression

G1096603 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1096603 Expression in each Bioproject

Bar chart with 19 bars.
G1096603 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
eurasian perch (Perca fluviatilis) G79224 NA non-coding NC_053118.1 CM020915.1 37394127 ~ 37394511 (-)
tiger barb (Puntius tetrazona) G71631 LOC107660592,LOC107728907 non-coding NC_056707.1 CM032076.1 19755866 ~ 19756178 (+)