G1099157



Basic Information


Item Value
gene id G1099157
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 64254615 ~ 64254853 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1250042
tctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaggaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttcaattt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1250042 True 239 lncRNA 0.46 1 64254615 64254853

Neighbor


gene id symbol gene type direction distance location
LOC110538011 LOC106607439 coding downstream 46883 64166272 ~ 64207732 (-)
LOC110538009 LOC106600900 coding downstream 123709 64118505 ~ 64130906 (-)
LOC110538008 dnal4 coding downstream 145402 64106180 ~ 64109213 (-)
LOC110538005 LOC106566277 coding downstream 170193 64075983 ~ 64084422 (-)
LOC118936383 LOC106600904 coding downstream 192976 64050215 ~ 64061639 (-)
LOC110538013 LOC106600896 coding upstream 25062 64279915 ~ 64291649 (-)
LOC110538014 LOC106600895 coding upstream 72031 64326884 ~ 64329769 (-)
LOC110538934 LOC106607443 coding upstream 76478 64331331 ~ 64337942 (-)
LOC110538015 LOC106600892 coding upstream 88592 64343445 ~ 64361994 (-)
LOC110538017 atf4 coding upstream 128345 64383198 ~ 64385075 (-)
G1099154 NA non-coding downstream 4768 64249623 ~ 64249847 (-)
G1099152 NA non-coding downstream 6424 64247895 ~ 64248191 (-)
G1099117 NA non-coding downstream 8721 64244544 ~ 64245894 (-)
G1099118 NA non-coding downstream 11053 64243225 ~ 64243562 (-)
G1099151 NA non-coding downstream 24230 64230159 ~ 64230385 (-)
G1099158 NA non-coding upstream 272 64255125 ~ 64255382 (-)
G1099160 NA non-coding upstream 6886 64261739 ~ 64262063 (-)
G1099161 NA non-coding upstream 8407 64263260 ~ 64263517 (-)
G1099082 NA non-coding upstream 11845 64266698 ~ 64267275 (-)
G1099507 NA non-coding upstream 61722 64316575 ~ 64316794 (-)
G1099144 LOC105893191 other downstream 33043 64220968 ~ 64221572 (-)
G1099090 LOC105030512 other downstream 113703 64140462 ~ 64140912 (-)
lmx1al LOC106600915 other downstream 568806 63659040 ~ 63685854 (-)
LOC110537983 LOC106600926 other downstream 787682 63453115 ~ 63467479 (-)
G1098256 LOC106600954 other downstream 1764361 62380280 ~ 62490254 (-)
G1099482 LOC106600895 other upstream 72046 64326899 ~ 64332071 (-)
G1099535 NA other upstream 112562 64367415 ~ 64367770 (-)
G1099816 NA other upstream 563526 64818379 ~ 64818729 (-)
LOC118937713 ifn1 other upstream 1645520 65900373 ~ 65904872 (-)
G1101510 NA other upstream 1932006 66186859 ~ 66187244 (-)

Expression


G1099157 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1099157 Expression in each Bioproject

Bar chart with 16 bars.
G1099157 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network