G1110450



Basic Information


Item Value
gene id G1110450
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 73715693 ~ 73716381 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1262543
tcaatgacacatacacacacgccaccttcctgttctctctcaatgacacacacacacacacacacacacctccttcctgtactctctcaatgacacacacacaccaccttcctgtactctctcaatgacacacacacaccaccttcctgttctctgtcaatgacacacacacaccaccttcctgttctctgtcaatgacacacacacacacacacaccaccttcctgttctctctcaatgacacacacacacacgccaccttcctgttctctctcaatgacacacacacacctcctac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1262543 True 298 lncRNA 0.49 2 73715693 73716381
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937733 LOC100135791 coding downstream 22392 73692246 ~ 73693301 (-)
LOC118937732 LOC100135791 coding downstream 30227 73684425 ~ 73685466 (-)
LOC110513784 LOC100135791 coding downstream 38020 73676632 ~ 73677673 (-)
LOC110538434 LOC100135790 coding downstream 46010 73668763 ~ 73669683 (-)
LOC110538435 LOC100135791 coding downstream 48406 73666463 ~ 73667287 (-)
LOC110538430 LOC106601059 coding upstream 16987 73733368 ~ 73774664 (-)
LOC110538428 LOC106601057 coding upstream 90747 73807128 ~ 73814783 (-)
LOC110538427 LOC106607220 coding upstream 102875 73819256 ~ 73845432 (-)
LOC110538426 LOC106601288 coding upstream 177596 73893977 ~ 73911270 (-)
LOC110538425 LOC106601287 coding upstream 195493 73911874 ~ 73926544 (-)
G1110447 NA non-coding downstream 399 73712876 ~ 73715294 (-)
G1110410 LOC106607381 non-coding downstream 36285 73650152 ~ 73679408 (-)
G1110412 LOC100135791 non-coding downstream 62182 73647137 ~ 73653511 (-)
G1110409 LOC100135791 non-coding downstream 74303 73629059 ~ 73641390 (-)
G1110372 NA non-coding downstream 125863 73562820 ~ 73589830 (-)
G1110439 NA non-coding upstream 14121 73730502 ~ 73733171 (-)
G1110476 LOC106607222 non-coding upstream 78765 73795146 ~ 73795641 (-)
G1110434 NA non-coding upstream 99376 73815757 ~ 73818186 (-)
G1110440 NA non-coding upstream 101908 73818289 ~ 73818591 (-)
G1110477 NA non-coding upstream 102381 73818762 ~ 73819090 (-)
G1110374 NA other downstream 101425 73612577 ~ 73614268 (-)
G1110369 hbb1 other downstream 120335 73582194 ~ 73595358 (-)
LOC110538455 LOC106601085 other downstream 246084 73462257 ~ 73510350 (-)
G1109389 LOC106601099 other downstream 634291 73072892 ~ 73081402 (-)
G1109275 NA other downstream 790442 72924157 ~ 72925251 (-)
LOC110538422 LOC106601282 other upstream 351904 74068285 ~ 74079316 (-)
G1110701 NA other upstream 487840 74204221 ~ 74205191 (-)
G1110941 NA other upstream 933902 74650283 ~ 74650763 (-)
G1111424 LOC106601260 other upstream 1101594 74817975 ~ 74824590 (-)
G1111451 NA other upstream 1164117 74880498 ~ 74880807 (-)

Expression


G1110450 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1110450 Expression in each Bioproject

Bar chart with 16 bars.
G1110450 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network