G1110941



Basic Information


Item Value
gene id G1110941
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 74650283 ~ 74650763 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1263089
acaccgccatggattaaaatcctgcagcccacgcaaggtccccctgctcaagccagctcatgtccaggcccgtctgaagtttgccaatgaccatctggatgatccagaggaggaatgggagaaggtcatgtggtctgatgagacaaaaatagagctttttggtctaaactccacttgccgtgtttggaggaagaagaaggatgagtacaaccccaagaacaccatcccaaccgtgaagcatggaggtggaaacataattctttggggatgcttttctgcaaaggggacaggacgactgcaccgtattgaggggagggtggatggggccatgtatcgcgagatcttggccaacaacctccttccctcagtaagagcattgaagatgggtcgtgactgggtcttccagcatgacaatgacccgaaacacacaggcagggcaactaaggagtggcggcgtaagaagcatctcaaggtcctggag

Function


NR:

description
Transposable element Tcb1 transposase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1263089 True 481 TUCP 0.52 1 74650283 74650763

Neighbor


gene id symbol gene type direction distance location
LOC110538407 LOC106607192 coding downstream 39498 74605118 ~ 74610785 (-)
LOC110538408 LOC100194731 coding downstream 58437 74588449 ~ 74591846 (-)
LOC118937742 LOC106601296 coding downstream 66193 74580901 ~ 74584090 (-)
LOC110538409 myst2 coding downstream 73020 74565358 ~ 74577263 (-)
LOC110538970 LOC106607203 coding downstream 256176 74304520 ~ 74394107 (-)
LOC110538969 LOC106607189 coding upstream 63892 74714655 ~ 74720474 (-)
LOC110538399 rl23 coding upstream 134052 74784815 ~ 74788141 (-)
LOC110538394 LOC106601258 coding upstream 186742 74837361 ~ 74937056 (-)
LOC110538392 LOC106601294 coding upstream 288327 74939090 ~ 74940118 (-)
LOC110538389 LOC106601255 coding upstream 453707 75104470 ~ 75113299 (-)
G1110940 NA non-coding downstream 344 74649720 ~ 74649939 (-)
G1110935 NA non-coding downstream 10341 74639717 ~ 74639942 (-)
G1110888 NA non-coding downstream 35805 74531224 ~ 74614478 (-)
G1110875 NA non-coding downstream 133934 74516101 ~ 74516349 (-)
G1110714 NA non-coding downstream 230704 74226460 ~ 74419579 (-)
G1110942 NA non-coding upstream 430 74651193 ~ 74651430 (-)
G1110949 NA non-coding upstream 7221 74657984 ~ 74658436 (-)
G1110969 NA non-coding upstream 23644 74674407 ~ 74674784 (-)
G1110974 NA non-coding upstream 32038 74682801 ~ 74687644 (-)
G1110980 NA non-coding upstream 39806 74690569 ~ 74690773 (-)
G1110701 NA other downstream 445092 74204221 ~ 74205191 (-)
LOC110538422 LOC106601282 other downstream 571006 74068285 ~ 74079316 (-)
G1110374 NA other downstream 1036015 73612577 ~ 73614268 (-)
G1110369 hbb1 other downstream 1054925 73582194 ~ 73595358 (-)
LOC110538455 LOC106601085 other downstream 1180674 73462257 ~ 73510350 (-)
G1111424 LOC106601260 other upstream 167212 74817975 ~ 74824590 (-)
G1111451 NA other upstream 229735 74880498 ~ 74880807 (-)
G1111672 NA other upstream 539422 75190185 ~ 75190431 (-)
G1112697 LOC106607147 other upstream 1145687 75796450 ~ 75796798 (-)
G1112997 NA other upstream 1730165 76380928 ~ 76381727 (-)

Expression


G1110941 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1110941 Expression in each Bioproject

Bar chart with 20 bars.
G1110941 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network