G1111579



Basic Information


Item Value
gene id G1111579
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 75081065 ~ 75081361 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1263780
TTTGGCGTAAAAGTGTGCAATGAAATGTGGTAAACAAATAGACAAGAGGTGTGGCTGGCACAGTGACTCACCTGCCACAGAGTTGGGCCGGGGCATGAGGTAGAGGGGGATGGAGTGGGCAGAGTGGGAGGAGTGGGCCGTCTCCAGGCTCCTCTCTGGGATCTTGTTCAGGCTGTAGGTGGAGGCAGCCATGTTCTCATCCACGCGGTACAGGAACGAGTCTGTGCCCAAACACTTCTGGGTCTGCCACAGCTTCAGGCTACCCCGCGAGCCCTCCCCATGCTTCCCCCCACCCCG

Function


NR:

description
protein TANC2-like isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1263780 True 297 lncRNA 0.59 1 75081065 75081361

Neighbor


gene id symbol gene type direction distance location
LOC110538392 LOC106601294 coding downstream 140947 74939090 ~ 74940118 (-)
LOC110538394 LOC106601258 coding downstream 144009 74837361 ~ 74937056 (-)
LOC110538399 rl23 coding downstream 292924 74784815 ~ 74788141 (-)
LOC110538969 LOC106607189 coding downstream 360591 74714655 ~ 74720474 (-)
LOC110538407 LOC106607192 coding downstream 470280 74605118 ~ 74610785 (-)
LOC110538389 LOC106601255 coding upstream 23109 75104470 ~ 75113299 (-)
LOC110538387 NA coding upstream 136207 75216004 ~ 75220939 (-)
LOC110538381 LOC106601248 coding upstream 210584 75288118 ~ 75366262 (-)
desi1a LOC106601247 coding upstream 350188 75431549 ~ 75434649 (-)
LOC110538375 LOC106607167 coding upstream 383726 75465087 ~ 75501246 (-)
G1111578 NA non-coding downstream 2752 75077533 ~ 75078313 (-)
G1111592 NA non-coding downstream 8483 75072332 ~ 75072582 (-)
G1111558 NA non-coding downstream 35875 75035827 ~ 75045190 (-)
G1111530 NA non-coding downstream 60425 74999751 ~ 75020640 (-)
G1111458 NA non-coding downstream 184819 74896029 ~ 74896246 (-)
G1111598 LOC106601254 non-coding upstream 8220 75089581 ~ 75089850 (-)
G1111603 LOC106607178 non-coding upstream 11695 75093056 ~ 75099174 (-)
G1111661 NA non-coding upstream 90661 75172022 ~ 75172227 (-)
G1111666 NA non-coding upstream 101068 75182429 ~ 75182666 (-)
G1111673 NA non-coding upstream 109804 75191165 ~ 75191495 (-)
G1111451 NA other downstream 200258 74880498 ~ 74880807 (-)
G1111424 LOC106601260 other downstream 256475 74817975 ~ 74824590 (-)
G1110941 NA other downstream 430302 74650283 ~ 74650763 (-)
G1110701 NA other downstream 875874 74204221 ~ 74205191 (-)
LOC110538422 LOC106601282 other downstream 1001788 74068285 ~ 74079316 (-)
G1111672 NA other upstream 108824 75190185 ~ 75190431 (-)
G1112697 LOC106607147 other upstream 715089 75796450 ~ 75796798 (-)
G1112997 NA other upstream 1299567 76380928 ~ 76381727 (-)
G1113013 NA other upstream 1331579 76412940 ~ 76414211 (-)
LOC110538323 NA other upstream 1347187 76428548 ~ 76478939 (-)

Expression


G1111579 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1111579 Expression in each Bioproject

Bar chart with 7 bars.
G1111579 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network