G1111727



Basic Information


Item Value
gene id G1111727
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 75274873 ~ 75275105 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1263941
GGATGGTGTGGTAGTTGTAGTGTTGCTGCTGCTGGTTGAGGATCTGCAGCTGGAGGAAGAGCTGCTGCTGGTGGAGGATCTTGGCGTAGGTGGAGTCCAGCTGAGGGGGCGGCTCGTGGTCGGCCTTCTGGTCCGGGGGGATGTACTGGTGGTACTTCAGCTTCCTCACCTTGGGCTTGTTGTCCTTGGGCTTCTTGGATCGCTGAGGGGGGCGTTCTGAGGTGGGCTTTGGC

Function


NR:

description
MKL/myocardin-like protein 1 isoform X6

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1263941 True 233 lncRNA 0.61 1 75274873 75275105
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110538387 NA coding downstream 56897 75216004 ~ 75220939 (-)
LOC110538389 LOC106601255 coding downstream 161574 75104470 ~ 75113299 (-)
LOC110538392 LOC106601294 coding downstream 334755 74939090 ~ 74940118 (-)
LOC110538394 LOC106601258 coding downstream 337817 74837361 ~ 74937056 (-)
LOC110538399 rl23 coding downstream 486732 74784815 ~ 74788141 (-)
LOC110538381 LOC106601248 coding upstream 16840 75288118 ~ 75366262 (-)
desi1a LOC106601247 coding upstream 156444 75431549 ~ 75434649 (-)
LOC110538375 LOC106607167 coding upstream 189982 75465087 ~ 75501246 (-)
LOC110538376 xpp3 coding upstream 226487 75501592 ~ 75510877 (-)
rbx1 rbx1 coding upstream 259172 75534272 ~ 75537366 (-)
G1111724 NA non-coding downstream 1866 75272780 ~ 75273007 (-)
G1111723 NA non-coding downstream 3328 75271329 ~ 75271545 (-)
G1111722 NA non-coding downstream 8380 75265864 ~ 75266493 (-)
G1111721 NA non-coding downstream 10964 75263439 ~ 75263909 (-)
G1111720 NA non-coding downstream 13110 75261410 ~ 75261763 (-)
G1111725 NA non-coding upstream 405 75275510 ~ 75275944 (-)
G1111726 NA non-coding upstream 4055 75279160 ~ 75281008 (-)
G1111731 NA non-coding upstream 11607 75286712 ~ 75286941 (-)
G1112517 NA non-coding upstream 134348 75409453 ~ 75428071 (-)
G1111672 NA other downstream 84442 75190185 ~ 75190431 (-)
G1111451 NA other downstream 394066 74880498 ~ 74880807 (-)
G1111424 LOC106601260 other downstream 450283 74817975 ~ 74824590 (-)
G1110941 NA other downstream 624110 74650283 ~ 74650763 (-)
G1110701 NA other downstream 1069682 74204221 ~ 74205191 (-)
G1112697 LOC106607147 other upstream 521345 75796450 ~ 75796798 (-)
G1112997 NA other upstream 1105823 76380928 ~ 76381727 (-)
G1113013 NA other upstream 1137835 76412940 ~ 76414211 (-)
LOC110538323 NA other upstream 1153443 76428548 ~ 76478939 (-)
G1113043 LOC106601201 other upstream 1209267 76484372 ~ 76485285 (-)

Expression


G1111727 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1111727 Expression in each Bioproject

Bar chart with 14 bars.
G1111727 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network