G1112553



Basic Information


Item Value
gene id G1112553
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 75487945 ~ 75491023 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1264933
caaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatggttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttcccggtccctgctgaagaaaagcaggcccaaac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1264933 True 332 lncRNA 0.44 2 75487945 75491023

Neighbor


gene id symbol gene type direction distance location
desi1a LOC106601247 coding downstream 53296 75431549 ~ 75434649 (-)
LOC110538381 LOC106601248 coding downstream 121683 75288118 ~ 75366262 (-)
LOC110538387 NA coding downstream 269969 75216004 ~ 75220939 (-)
LOC110538389 LOC106601255 coding downstream 374646 75104470 ~ 75113299 (-)
LOC110538392 LOC106601294 coding downstream 547827 74939090 ~ 74940118 (-)
LOC110538376 xpp3 coding upstream 10569 75501592 ~ 75510877 (-)
rbx1 rbx1 coding upstream 43254 75534272 ~ 75537366 (-)
LOC110538966 LOC106607166 coding upstream 46531 75537554 ~ 75552963 (-)
LOC110538374 LOC106607164 coding upstream 64510 75555533 ~ 75561122 (-)
LOC110538370 LOC106601240 coding upstream 140032 75631055 ~ 75637902 (-)
G1112517 NA non-coding downstream 59874 75409453 ~ 75428071 (-)
G1111731 NA non-coding downstream 201004 75286712 ~ 75286941 (-)
G1111726 NA non-coding downstream 206937 75279160 ~ 75281008 (-)
G1111725 NA non-coding downstream 212001 75275510 ~ 75275944 (-)
G1112562 NA non-coding upstream 38338 75529361 ~ 75529671 (-)
G1112563 NA non-coding upstream 38794 75529817 ~ 75530104 (-)
G1112565 NA non-coding upstream 48416 75539439 ~ 75539655 (-)
G1112587 NA non-coding upstream 94360 75585383 ~ 75585746 (-)
G1111672 NA other downstream 297514 75190185 ~ 75190431 (-)
G1111451 NA other downstream 607138 74880498 ~ 74880807 (-)
G1111424 LOC106601260 other downstream 663355 74817975 ~ 74824590 (-)
G1110941 NA other downstream 837182 74650283 ~ 74650763 (-)
G1110701 NA other downstream 1282754 74204221 ~ 74205191 (-)
G1112697 LOC106607147 other upstream 305427 75796450 ~ 75796798 (-)
G1112997 NA other upstream 889905 76380928 ~ 76381727 (-)
G1113013 NA other upstream 921917 76412940 ~ 76414211 (-)
LOC110538323 NA other upstream 937525 76428548 ~ 76478939 (-)
G1113043 LOC106601201 other upstream 993349 76484372 ~ 76485285 (-)

Expression


G1112553 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1112553 Expression in each Bioproject

Bar chart with 20 bars.
G1112553 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network