G1112860



Basic Information


Item Value
gene id G1112860
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 76109132 ~ 76109371 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1265294
catgtaaagtgttggtcccatgtttcatgagctgaaataaaatatcccagaactcttccatatacacaaaaagcatatttctcaatgttgtgcataaatttgtttacatcccctgttagtgagcatttctcctttgccaagataatccaaaggtgtggcatttcaagaaactgattaaccggcatgatcattacacaggtgcaccttgttctggggacaacaaaaggccactttaaaatg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1265294 True 240 lncRNA 0.38 1 76109132 76109371

Neighbor


gene id symbol gene type direction distance location
LOC118937981 NA coding downstream 10402 76098552 ~ 76099257 (-)
LOC110538338 LOC106607128 coding downstream 14473 76085941 ~ 76094659 (-)
LOC110538346 LOC106607136 coding downstream 137201 75962013 ~ 75971931 (-)
LOC110538347 LOC106601217 coding downstream 148935 75956776 ~ 75960197 (-)
LOC110538349 LOC106607139 coding downstream 175249 75932173 ~ 75933883 (-)
LOC110538335 LOC106601210 coding upstream 9455 76113299 ~ 76125699 (-)
LOC110538331 LOC106601211 coding upstream 17453 76126824 ~ 76136107 (-)
LOC110538329 LOC106601205 coding upstream 230209 76339580 ~ 76346185 (-)
LOC100135986 LOC100135986 coding upstream 251797 76361168 ~ 76375725 (-)
LOC110538326 LOC106601203 coding upstream 310749 76420120 ~ 76425165 (-)
G1112851 NA non-coding downstream 10658 76098155 ~ 76098474 (-)
G1112847 NA non-coding downstream 19565 76088910 ~ 76089567 (-)
G1112835 NA non-coding downstream 27314 76079186 ~ 76081818 (-)
G1112828 srebf2 non-coding downstream 63063 76042167 ~ 76046069 (-)
G1112876 NA non-coding upstream 31515 76140886 ~ 76141100 (-)
G1112877 NA non-coding upstream 34881 76144252 ~ 76144516 (-)
G1112887 NA non-coding upstream 54597 76163968 ~ 76164669 (-)
G1112889 LOC106607101 non-coding upstream 57612 76166983 ~ 76167903 (-)
G1112697 LOC106607147 other downstream 312334 75796450 ~ 75796798 (-)
G1111672 NA other downstream 918701 75190185 ~ 75190431 (-)
G1111451 NA other downstream 1228325 74880498 ~ 74880807 (-)
G1111424 LOC106601260 other downstream 1284542 74817975 ~ 74824590 (-)
G1110941 NA other downstream 1458369 74650283 ~ 74650763 (-)
G1112997 NA other upstream 271557 76380928 ~ 76381727 (-)
G1113013 NA other upstream 303569 76412940 ~ 76414211 (-)
LOC110538323 NA other upstream 319177 76428548 ~ 76478939 (-)
G1113043 LOC106601201 other upstream 375001 76484372 ~ 76485285 (-)
LOC110538302 LOC106601359 other upstream 719411 76828760 ~ 76844798 (-)

Expression


G1112860 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1112860 Expression in each Bioproject

Bar chart with 10 bars.
G1112860 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network