G1113198



Basic Information


Item Value
gene id G1113198
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 76784680 ~ 76784922 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1265692
GGGCCCATGAGGCATGTTTTGTGCTGATAAGTGATGCACATCTCTGTGACTGATTAGGGGTACTTAGAGTGGGCTCTCTTATCTGCTTAGGAGGCAGGATAGTGAGAAGAGATAAGCATCCATCATTAGGCCTACCTCACAAACAAAGTACATACAAATGTATAATTAACTTGCTGCATTTTCCAATTGAACATGACACAAAATAAAAGTGCTTGATGTCATAAGACATTGTTAGGTCAGTGG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1265692 True 243 lncRNA 0.41 1 76784680 76784922
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110538309 LOC106601361 coding downstream 2660 76777014 ~ 76782020 (-)
LOC110538310 LOC106601366 coding downstream 8934 76759721 ~ 76775746 (-)
LOC110539169 LOC107548868 coding downstream 25208 76758252 ~ 76759472 (-)
LOC110538311 tsn16 coding downstream 26753 76749264 ~ 76757927 (-)
LOC110538312 LOC106601368 coding downstream 36941 76734597 ~ 76747739 (-)
LOC110538308 epor coding upstream 1375 76786296 ~ 76793231 (-)
rab3a rab3a coding upstream 9257 76794179 ~ 76804653 (-)
LOC110538305 LOC106596625 coding upstream 22045 76806967 ~ 76809411 (-)
LOC110538304 cnn1 coding upstream 30344 76815266 ~ 76824161 (-)
LOC110538302 LOC106601359 coding upstream 43838 76828760 ~ 76844798 (-)
G1113184 NA non-coding downstream 53393 76730896 ~ 76731287 (-)
G1113104 NA non-coding downstream 148384 76586533 ~ 76636296 (-)
G1113130 NA non-coding downstream 153771 76630424 ~ 76630909 (-)
G1113005 NA non-coding downstream 314435 76388951 ~ 76470245 (-)
G1112992 NA non-coding downstream 407511 76376651 ~ 76377169 (-)
G1113216 NA non-coding upstream 60443 76845365 ~ 76867660 (-)
G1113467 NA non-coding upstream 142039 76926961 ~ 76927473 (-)
G1113483 NA non-coding upstream 184936 76969858 ~ 76971934 (-)
G1113491 NA non-coding upstream 197982 76982904 ~ 76983239 (-)
G1113043 LOC106601201 other downstream 299395 76484372 ~ 76485285 (-)
LOC110538323 NA other downstream 351110 76428548 ~ 76478939 (-)
G1113013 NA other downstream 370469 76412940 ~ 76414211 (-)
G1112997 NA other downstream 402953 76380928 ~ 76381727 (-)
G1112697 LOC106607147 other downstream 987882 75796450 ~ 75796798 (-)
G1114604 LOC106607027 other upstream 697189 77482111 ~ 77484731 (-)
LOC110538477 LOC106607035 other upstream 825923 77610820 ~ 77612826 (-)
G1114714 NA other upstream 909573 77694495 ~ 77695275 (-)
LOC110539174 prdx2 other upstream 919585 77704482 ~ 77719934 (-)

Expression


G1113198 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1113198 Expression in each Bioproject

Bar chart with 6 bars.
G1113198 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network