G1113665



Basic Information


Item Value
gene id G1113665
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 77240118 ~ 77240320 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1266241
CAATAGGAGAGATTTGTCAGATGTTCTCTGTAAGCTAAGGTTTGGGATGGGACTGATGGTAAATGAGCTTCTGGAGTCATTGGTGTTTTACAAGGGTTAAGTCAGTGGGGTAACTTAGAGAGCTTTATCGATATTTAGAAAGTGCCTTAAGAAAGATCCCATCATGGTTAGCAACACACCAAGGAACTGTGACTGTATCAGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1266241 True 203 lncRNA 0.41 1 77240118 77240320
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110538288 LOC106607073 coding downstream 45771 77169823 ~ 77194374 (-)
LOC110538289 LOC106601349 coding downstream 73467 77147190 ~ 77166651 (-)
LOC110538291 LOC106601350 coding downstream 97918 77131049 ~ 77142200 (-)
syce2 LOC106601352 coding downstream 117086 77121547 ~ 77123032 (-)
LOC110538294 LOC106601353 coding downstream 130599 77084949 ~ 77109519 (-)
si:ch211-194b1.1 LOC106601342 coding upstream 30313 77270633 ~ 77289586 (-)
pglyrp6 LOC106601345 coding upstream 50110 77290430 ~ 77302205 (-)
LOC110538465 LOC106607026 coding upstream 205204 77445524 ~ 77450347 (-)
LOC110539172 LOC106607008 coding upstream 229537 77469857 ~ 77478487 (-)
LOC110538468 LOC106601163 coding upstream 253273 77493593 ~ 77501440 (-)
G1113649 NA non-coding downstream 10711 77229114 ~ 77229407 (-)
G1113637 NA non-coding downstream 21007 77218879 ~ 77219111 (-)
G1113635 NA non-coding downstream 23419 77216171 ~ 77216699 (-)
G1113515 NA non-coding downstream 111172 77128547 ~ 77128946 (-)
G1113682 NA non-coding upstream 6533 77246853 ~ 77250827 (-)
G1113686 NA non-coding upstream 11230 77251550 ~ 77251772 (-)
G1113687 NA non-coding upstream 11618 77251938 ~ 77252161 (-)
G1114503 NA non-coding upstream 56626 77296946 ~ 77297374 (-)
G1114531 LOC106601339 non-coding upstream 149705 77390025 ~ 77445496 (-)
LOC110538302 LOC106601359 other downstream 404835 76828760 ~ 76844798 (-)
G1113043 LOC106601201 other downstream 754833 76484372 ~ 76485285 (-)
LOC110538323 NA other downstream 806548 76428548 ~ 76478939 (-)
G1113013 NA other downstream 825907 76412940 ~ 76414211 (-)
G1112997 NA other downstream 858391 76380928 ~ 76381727 (-)
G1114604 LOC106607027 other upstream 241791 77482111 ~ 77484731 (-)
LOC110538477 LOC106607035 other upstream 370525 77610820 ~ 77612826 (-)
G1114714 NA other upstream 454175 77694495 ~ 77695275 (-)
LOC110539174 prdx2 other upstream 464187 77704482 ~ 77719934 (-)
G1114809 smarca4 other upstream 618542 77858862 ~ 77862506 (-)

Expression


G1113665 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1113665 Expression in each Bioproject

Bar chart with 3 bars.
G1113665 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network