G1116120



Basic Information


Item Value
gene id G1116120
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 79454130 ~ 79454620 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1269099
gaagacggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggtagcatcatggtttgggcccgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacttgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaattgagaatatgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaaattcag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1269099 True 491 TUCP 0.43 1 79454130 79454620
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110538545 ubald2 coding downstream 53916 79379952 ~ 79437413 (-)
LOC110538542 srsf2 coding downstream 100333 79350670 ~ 79353797 (-)
LOC110538541 jmjd6 coding downstream 104981 79335937 ~ 79349149 (-)
LOC110538537 LOC106601432 coding downstream 119371 79306407 ~ 79334759 (-)
LOC110538981 st6galnac2 coding downstream 154811 79292265 ~ 79299319 (-)
LOC110538550 LOC105022923 coding upstream 146560 79601180 ~ 79680434 (-)
LOC110538551 LOC102192139 coding upstream 245359 79699979 ~ 80112645 (-)
LOC110538563 LOC106580481 coding upstream 745418 80200038 ~ 80201563 (-)
ppct LOC106601485 coding upstream 767883 80222503 ~ 80228591 (-)
LOC110538567 LOC106606950 coding upstream 811683 80266303 ~ 80349063 (-)
G1116079 NA non-coding downstream 76208 79377694 ~ 79377922 (-)
G1116078 NA non-coding downstream 77484 79376398 ~ 79376646 (-)
G1116075 NA non-coding downstream 79950 79367163 ~ 79374180 (-)
G1116072 NA non-coding downstream 92808 79361107 ~ 79361322 (-)
G1116121 NA non-coding upstream 1204 79455824 ~ 79456049 (-)
G1116123 NA non-coding upstream 3196 79457816 ~ 79458030 (-)
G1116125 NA non-coding upstream 5956 79460576 ~ 79460817 (-)
G1116128 NA non-coding upstream 10812 79465432 ~ 79465782 (-)
G1116131 NA non-coding upstream 15619 79470239 ~ 79471083 (-)
G1116006 NA other downstream 236007 79217551 ~ 79218123 (-)
LOC110538491 il-8 other downstream 1470900 77966821 ~ 77984741 (-)
G1114809 smarca4 other downstream 1591624 77858862 ~ 77862506 (-)
LOC110539174 prdx2 other downstream 1744258 77704482 ~ 77719934 (-)
G1114714 NA other downstream 1758855 77694495 ~ 77695275 (-)
LOC110539175 LOC106601487 other upstream 919977 80374395 ~ 80376801 (-)
G1117808 NA other upstream 1292959 80747579 ~ 80748056 (-)
LOC110538585 LOC106601460 other upstream 1317078 80771698 ~ 80786963 (-)
G1117879 NA other upstream 1416155 80870775 ~ 80874214 (-)

Expression


G1116120 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1116120 Expression in each Bioproject

Bar chart with 18 bars.
G1116120 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network