G1118436



Basic Information


Item Value
gene id G1118436
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 81742310 ~ 81742652 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1271723
cacattacccaacctcaccaccactattcataacacattacccaacctcaccaccactattcataacccgttacccaacctcaccaccactattcattacacattacccaacctcaccaccactattcataacacaatacccaacctcaccaccactattcataacccattacccaacctcaccaccactattcattacacattacccaacctcaccaccactattcataacacattacccaacctcaccaccactattcattacacattacccaacctcaccaccactattcataacccattacccaacctcaccaccactattcataacacattacccaac

Function


NR:

description
PREDICTED: uncharacterized protein LOC106596100

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1271723 True 343 lncRNA 0.44 1 81742310 81742652

Neighbor


gene id symbol gene type direction distance location
LOC110538618 NA coding upstream 14298 81725570 ~ 81728012 (+)
LOC118937941 NA coding upstream 15746 81726477 ~ 81726564 (+)
LOC118937942 NA coding upstream 15990 81726233 ~ 81726320 (+)
LOC118937943 NA coding upstream 16219 81726004 ~ 81726091 (+)
mybpc2a LOC106601538 coding upstream 201437 81483350 ~ 81540873 (+)
LOC110538622 LOC106606881 coding downstream 149464 81892116 ~ 81895379 (+)
prf1 prf1 coding downstream 182218 81924870 ~ 81928078 (+)
LOC100335037 LOC106606889 coding downstream 235083 81977678 ~ 81980288 (+)
LOC110538628 LOC106606892 coding downstream 248227 81990879 ~ 81992395 (+)
LOC110538634 NA coding downstream 306844 82049496 ~ 82052478 (+)
G1118432 NA non-coding upstream 16898 81725129 ~ 81725412 (+)
G1118425 NA non-coding upstream 23167 81717253 ~ 81719143 (+)
G1118379 NA non-coding upstream 28166 81625319 ~ 81714144 (+)
G1118401 NA non-coding upstream 89289 81652442 ~ 81653021 (+)
G1118377 NA non-coding upstream 117046 81623157 ~ 81625264 (+)
G1118437 NA non-coding downstream 2362 81745014 ~ 81745443 (+)
G1118438 NA non-coding downstream 3844 81746496 ~ 81746926 (+)
G1118440 NA non-coding downstream 14561 81757213 ~ 81757508 (+)
G1118441 NA non-coding downstream 17173 81759825 ~ 81760044 (+)
G1118442 NA non-coding downstream 17442 81760094 ~ 81760398 (+)
G1118433 NA other upstream 14298 81725608 ~ 81728012 (+)
G1118337 NA other upstream 150079 81551279 ~ 81592231 (+)
G1118287 NA other upstream 272623 81469306 ~ 81469687 (+)
G1118102 LOC106593559 other upstream 430806 81308626 ~ 81311504 (+)
G1118488 NA other downstream 152838 81895490 ~ 81896290 (+)
LOC110538650 ndua4 other downstream 602556 82345174 ~ 82373637 (+)
LOC100136955 LOC100136955 other downstream 1055576 82788554 ~ 82799768 (+)
G1118965 NA other downstream 1143335 82885987 ~ 82886964 (+)

Expression


G1118436 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1118436 Expression in each Bioproject

Bar chart with 11 bars.
G1118436 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network