G1127452



Basic Information


Item Value
gene id G1127452
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 92428741 ~ 92429077 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1282333
gaaataacacatggaatcatgaggtaaccaaaaaagtgttaaacgaatcaaaatatattttatatttgagattcttcaaatagccaccacactcttggcattctctcaaccagcttcatgaggtagtcacctggaaagcatttcaattaacaggtgtgccttgttaaaagttcatttgtggaatttctttccttcttaatgtgtttgagccaatcagttgtgttgtgacaaggtaggggtggtacagaagacagcactatttggtaaaaaaaacgagtccatattatggcaaagagaaatgacagtccatcattactttaagacatgaaggtcagtc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1282333 True 337 lncRNA 0.36 1 92428741 92429077
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110513965 lg3bp coding downstream 341227 92081486 ~ 92087514 (-)
LOC118936479 LOC106595712 coding downstream 354112 92070327 ~ 92074629 (-)
LOC118937779 LOC106606432 coding downstream 379040 92045168 ~ 92049701 (-)
LOC110487071 LOC106595712 coding downstream 392762 92031632 ~ 92035979 (-)
LOC118937778 LOC106606432 coding downstream 418220 92005828 ~ 92010521 (-)
LOC110486093 LOC106606427 coding upstream 29416 92458493 ~ 92486264 (-)
LOC110486090 LOC105012845 coding upstream 74629 92503706 ~ 92526039 (-)
LOC110516409 LOC106594801 coding upstream 169803 92598880 ~ 92802145 (-)
LOC110487086 LOC106601910 coding upstream 444582 92873659 ~ 92877180 (-)
LOC118937833 otop2 coding upstream 519498 92948575 ~ 92952718 (-)
G1127440 NA non-coding downstream 21574 92406722 ~ 92407167 (-)
G1127365 NA non-coding downstream 92990 92333180 ~ 92335751 (-)
G1127390 NA non-coding downstream 109750 92318581 ~ 92318991 (-)
G1127366 NA non-coding downstream 140041 92288162 ~ 92288700 (-)
G1127367 NA non-coding downstream 140703 92286283 ~ 92288038 (-)
G1127461 NA non-coding upstream 4261 92433338 ~ 92433540 (-)
G1127467 NA non-coding upstream 5971 92435048 ~ 92435390 (-)
G1127469 NA non-coding upstream 8017 92437094 ~ 92437361 (-)
G1127470 NA non-coding upstream 9840 92438917 ~ 92439130 (-)
G1127417 NA other downstream 67123 92360002 ~ 92361618 (-)
G1126380 NA other downstream 1396915 91030856 ~ 91031826 (-)
G1126362 NA other downstream 1416239 91012135 ~ 91012502 (-)
G1126256 NA other downstream 1668620 90758010 ~ 90760121 (-)
G1127726 NA other upstream 287252 92715049 ~ 92718467 (-)
G1127735 NA other upstream 318717 92747794 ~ 92748215 (-)

Expression


G1127452 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1127452 Expression in each Bioproject

Bar chart with 20 bars.
G1127452 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network