G1127469



Basic Information


Item Value
gene id G1127469
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 92437094 ~ 92437361 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1282350
GCCATTACTGAGCCACTGACCTGATTACCTGTTCCATTACAATACAGAATTGTCTTGAAATTGACTGATGCAATATTTAGTCTCCCTAACACATCAAATTCAACAGACAGGCATTCAGGGAGATACTGCATGTCTTATACATTGTTTGTGTTTCACCTCAGAAGAGGTGAAACAGGTGGTTTAATAGCCATGGAGGTGTCCTGTAGTTGACAGGTATGAAAGGGTACATGTAGAATTGGAATTCAGTGAAACCCTTACGGCAGTACAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1282350 True 268 lncRNA 0.41 1 92437094 92437361
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110513965 lg3bp coding downstream 349580 92081486 ~ 92087514 (-)
LOC118936479 LOC106595712 coding downstream 362465 92070327 ~ 92074629 (-)
LOC118937779 LOC106606432 coding downstream 387393 92045168 ~ 92049701 (-)
LOC110487071 LOC106595712 coding downstream 401115 92031632 ~ 92035979 (-)
LOC118937778 LOC106606432 coding downstream 426573 92005828 ~ 92010521 (-)
LOC110486093 LOC106606427 coding upstream 21132 92458493 ~ 92486264 (-)
LOC110486090 LOC105012845 coding upstream 66345 92503706 ~ 92526039 (-)
LOC110516409 LOC106594801 coding upstream 161519 92598880 ~ 92802145 (-)
LOC110487086 LOC106601910 coding upstream 436298 92873659 ~ 92877180 (-)
LOC118937833 otop2 coding upstream 511214 92948575 ~ 92952718 (-)
G1127467 NA non-coding downstream 1704 92435048 ~ 92435390 (-)
G1127461 NA non-coding downstream 3554 92433338 ~ 92433540 (-)
G1127452 NA non-coding downstream 8017 92428741 ~ 92429077 (-)
G1127440 NA non-coding downstream 29927 92406722 ~ 92407167 (-)
G1127365 NA non-coding downstream 101343 92333180 ~ 92335751 (-)
G1127470 NA non-coding upstream 1556 92438917 ~ 92439130 (-)
G1127507 NA non-coding upstream 22582 92459943 ~ 92460220 (-)
G1127515 NA non-coding upstream 36580 92473941 ~ 92474175 (-)
G1127517 NA non-coding upstream 42031 92479392 ~ 92479713 (-)
G1127417 NA other downstream 75476 92360002 ~ 92361618 (-)
G1126380 NA other downstream 1405268 91030856 ~ 91031826 (-)
G1126362 NA other downstream 1424592 91012135 ~ 91012502 (-)
G1126256 NA other downstream 1676973 90758010 ~ 90760121 (-)
G1127726 NA other upstream 278968 92715049 ~ 92718467 (-)
G1127735 NA other upstream 310433 92747794 ~ 92748215 (-)

Expression


G1127469 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1127469 Expression in each Bioproject

Bar chart with 4 bars.
G1127469 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network